Genetically Engineered Food: Methods and Detection 2nd ed

Genetically Engineered Food Edited by Knut J. Heller

Related Titles

Wink, Michael (Ed.)

Ahmet E. Yousef, Carolyn Carstrom

An Introduction to Molecular Biotechnology

A Laboratory Manual

Molecular Fundamentals, Methods and Applications in Modern Biotechnology

Food Microbiology 2003 ISBN 0-471-39105-0

2006 ISBN 3-527-31412-1

Nakai, S., Modler, H. W. (eds.) The World Life Sciences Forum (Eds.)

Health for All? – Agriculture and Nutrition – Bioindustry and Environment

Food Proteins Processing Applications 2000 ISBN 0-471-29785-2

Analyses and Recommendations 2005 ISBN 3-527-31489-X

Sharma, S. K., Mulvaney, S. J., Rizvi, S. S. H.

Food Process Engineering Theory and Laboratory Experiments

Fischer, R., Schillberg, S. (eds.)

Molecular Farming Plant-made Pharmaceuticals and Technical Proteins 2004 ISBN 3-527-30786-9

2000 ISBN 0-471-32241-5

Genetically Engineered Food Methods and Detection Second, Updated and Enlarged Edition

Edited by Knut J. Heller

Editor

Prof. Dr. Knut J. Heller Institut für Mikrobiologie Bundesanstalt Milchforschung Hermann-Weigmann-Str. 1 24103 Kiel Germany 1st Edition 2003 1st Reprint 2004 2nd Edition 2006

All books published by Wiley-VCH are carefully produced. Nevertheless, authors, editors, and publisher do not warrant the information contained in these books, including this book, to be free of errors. Readers are advised to keep in mind that statements, data, illustrations, procedural details or other items may inadvertently be inaccurate. Library of Congress Card No.: applied for British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library. Bibliographic information published by the Deutsche Nationalbibliothek The Deutsche Nationalbibliothek lists this publication in the Deutsche Nationalbibliografie; detailed bibliographic data are available in the Internet at http://dnb.d-nb.de. © 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim All rights reserved (including those of translation into other languages). No part of this book may be reproduced in any form – by photoprinting, microfilm, or any other means – nor transmitted or translated into a machine language without written permission from the publishers. Registered names, trademarks, etc. used in this book, even when not specifically marked as such, are not to be considered unprotected by law. Printed in the Federal Republic of Germany Printed on acid-free paper

Composition Hagedorn Kommunikation, Viernheim Printing Strauss GmbH, Mörlenbach Bookbinding Litges & Dopf Buchbinderei GmbH, Heppenheim ISBN-13: 978-3-527-31393-8 ISBN-10: 3-527-31393-1

Contents Preface

XIII

List of Contributors

Part I

Application and Perspectives 1

Transgenic Modification of Production Traits in Farm Animals 3 Gottfried Brem and Mathias Müller Introduction 3 The Creation of Transgenic Animals 4 Pronuclear DNA Microinjection 4 Retroviral Vectors 5 Pluripotent Stem-cell Technology 6 Nuclear Transfer Using Transgenic Cells 6 Gene Transfer in Poultry 7 Gene Transfer in Fish 8 Transgenes – Gene Constructs 8 Transgenic Animals with Agricultural Traits 11 Improved Growth Rate, Carcass Composition, and Feed Efficiency 11 Transgenic Mammalian Farm Animals 11 Transgenic Fish 13 Alteration of the Composition of Milk 14 Improved Animal Health 16 Additive Gene Transfer of Resistance Genes 17 Gene Targeting of Susceptibility Genes 18 Improved Biochemical Pathways 19 Improved Wool Production 19 Transgenic Farm Animals, Biosafety Issues, Animal Welfare, and Ethics 20 Conclusion 21 References 22

1.1 1.2 1.2.1 1.2.2 1.2.3 1.2.4 1.3 1.4 1.5 1.6 1.7 1.7.1 1.7.2 1.8 1.9 1.9.1 1.9.2 1.10 1.11 1.12 1.13

Contents

2 2.1 2.1.1 2.1.1.1 2.1.1.2 2.1.2 2.1.3 2.1.3.1 2.1.3.2 2.1.3.3 2.2 2.2.1 2.2.2 2.2.3 2.3 2.3.1 2.3.1.1 2.3.1.2 2.3.1.3 2.3.1.4 2.3.2 2.3.2.1 2.3.2.2 2.3.2.3 2.3.2.4 2.3.2.5 2.3.2.6 2.3.2.7 2.3.3 2.3.3.1 2.3.3.2 2.3.4 2.3.4.1 2.3.4.2 2.4

Genetically Modified Plants 27 Susanne Stirn and Horst Lörz Methods for Establishing Genetically Modified Plants 27 Transformation Methods 27 Agrobacterium Transformation 27 Direct Gene Transfer 28 Tissue Requirements 29 Molecular Requirements 29 Promoter 29 Codon Usage 30 Selectable Marker and Reporter Genes 30 GM Plants Already on the Market (EU, USA, Canada, Japan) 32 Herbicide Resistance in Soybean, Maize, Oil-seed rape, Sugar Beet, Wheat, Rice, and Cotton 34 Insect Resistance in Maize, Potatoes, Tomatoes, and Cotton 34 Virus-resistance, Male Sterility, Delayed Fruit Ripening, and Fatty Acid Content of GMPs 36 GM Plants “In the Pipeline” 41 Input Traits 41 Insect Resistance 41 Virus, Fungal, Bacterial, and Nematode Resistance 42 Tolerance Against Abiotic Stress 45 Improved Agronomic Properties 47 Traits Affecting Food Quality for Human Nutrition 48 Increased Vitamin Content 48 Production of Very-long-chain Polyunsaturated Fatty Acids 49 Increased Iron Level 49 Improved Amino Acid Composition 49 Reduction in the Amount of Antinutritive Factors 50 Production of “Low-calorie Sugar” 50 Seedless Fruits and Vegetables 50 Traits that Affect Processing 51 Altered Gluten Level in Wheat to Change Baking Quality 51 Altered Grain Composition in Barley to Improve Malting Quality 51 Traits of Pharmaceutical Interest 52 Production of Vaccines 52 Production of Pharmaceuticals 53 Outlook 54 References 55

Contents

3.1 3.1.1 3.1.2 3.2 3.2.1 3.2.2 3.2.2.1 3.2.2.2 3.2.2.3 3.2.2.4 3.2.3 3.3 3.3.1 3.3.1.1 3.3.1.2 3.3.1.3 3.3.2 3.3.3 3.3.3.1 3.3.3.2 3.3.3.3 3.3.3.4 3.4

4 4.1 4.2 4.3 4.4

Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi 64 Rena Leisegang, Elke Nevoigt, Anja Spielvogel, Georg Kristan, Anke Niederhaus and Ulf Stahl Introduction 64 Why do we Ferment Foodstuffs? 64 Fermented Foods of Plant and Animal Origin 65 Yeast 67 Methods of Recombinant DNA Technology in Yeast 67 Genetically Modified Saccharomyces Strains 72 Beer 73 Wine 75 Sake 76 Bread 76 Genetically Modified Non-Saccharomyces Strains 77 Filamentous Fungi 78 Recombinant DNA Technology in Filamentous Fungi 78 Strategies used to Transform Filamentous Fungi 78 Selection Systems 79 The Fate of the Transforming DNA 80 Application of RNA-based Methods for Strain Improvement 81 Industrial Filamentous Fungi 82 Fungi Used for Fermentation of Plant Material 82 Fungal Oils and Other Metabolites 83 Fungal Proteins and Enzymes 83 Fungi as Single-cell Protein (SCP) 84 Prospects 85 Acknowledgements 85 References 86 Production of Food Additives Using Filamentous Fungi 95 Carsten M. Hjort Filamentous Fungi in Food Production 95 Additives for the Food Industry 98 Design of Genetically Modified Microorganisms for Production of Food Additives and Processing Aids 98 Industrial Enzyme Production Processes 105 References 107

VII

VIII

Contents

5 5.1 5.2 5.2.1 5.2.2 5.2.3 5.2.4 5.2.5 5.2.6 5.3 5.3.1 5.3.2 5.3.3 5.3.4 5.3.5 5.3.6 5.4 5.4.1 5.4.2 5.5

Genetic Engineering of Bacteria Used in Food Fermentation 109 Arnold Geis Introduction 109 Lactic Acid Bacteria 110 Lactococcus lactis subsp. lactis and subsp. cremoris 110 Lactobacillus spp. 111 Streptococcus thermophilus 113 Leuconastoc spp. 113 Pediococcus spp. 114 Oenococcus spp. 114 Perspectives and Objectives 115 Bioconservation 115 Bacteriophage Resistance 116 Exopolysaccharides 118 Proteolysis 119 Metabolic Engineering of Lactic Acid Bacteria 120 Stress Responses in Lactic Acid Bacteria 121 Methods 122 Transformation 122 Gene Delivery and Expression Systems 122 Conclusions 124 References 124

Part II

Legislation in Europe 133

The Legal Situation for Genetically Engineered Food in Europe 135 Rudolf Steinz and Jan Kalbheim Introduction 135 The Need for Regulation 135 The History of the Regulation of Genetically Modified Food 135 The Law Applicable to Genetically Modified Food 137 The Genetically Modified Food and Feed Regulation 137 Introduction 137 Scope of Application 138 Requirements for Genetically Modified Food and Feed 138 Procedure 138 Labeling 141 Other Questions 144 Problems 145 Negative Labeling 145 Coexistence of Genetically Modified Food and Feed and Conventional or Organic Food and Feed 145 Compliance with World Trade Law 147 Competent Authorities in the Member States 147

6.1 6.1.1 6.1.2 6.2 6.2.1 6.2.1.1 6.2.1.2 6.2.1.3 6.2.1.4 6.2.1.5 6.2.1.6 6.2.2 6.2.2.1 6.2.2.2 6.2.2.3 6.2.3

Contents

6.2.4 6.2.5

6.2.5.1 6.2.5.2 6.2.5.3 6.2.5.4

Relation to Directive 2001/18/EC of the EP and the Council 148 Supplementary National Provisions in German Law: The ECBI Act, the Biotechnology Act, and the Novel Foods and Food Ingredients Instrument 148 General Rules for Genetically Modified Food and Feed 148 Availability of Negative Labeling of Foodstuffs Made Without Using Procedures of Genetic Engineering 149 The Element of the Label 150 Rules on Criminal Offences and Misdemeanors 151 References 151

Part III Methods of Detection 155 7 7.1 7.2 7.3 7.4 8 8.1 8.2 8.2.1 8.2.2 8.3 8.3.1 8.4 8.4.1 8.4.2 8.4.3 8.5 8.5.1 8.5.2 8.5.3 8.5.4 8.5.5 8.5.6 8.5.7 8.6

Detection of Genetic Modifications – Some Basic Considerations 157 Knut J. Heller The Conversion of Genetic Information from DNA to Phenotypes 157 DNA, Protein, and Phenotypes as Targets for Detection Assays 158 Food-grade Modifications 161 Detection of Unknown Modifications 162 DNA-based Methods for Detection of Genetic Modifications 163 Ralf Einspanier Introduction 163 Recent DNA Methodology 164 Sampling Procedure 165 Extraction and Purification of DNA 165 Specific Detection of Genetic Material 166 DNA Hybridization-based Detection Technique (Southern Blot) 166 Nucleic Acid Amplification Methods using PCR 167 Conventional PCR 167 Real-time PCR 169 Important Bioinformatic Considerations 172 Alternative and Promising DNA Detection Techniques 173 Thermal Cycling Procedures 173 Isothermic Amplification 173 DNA Microarrays 174 Microfluidic and Nanoparticle Techniques 174 Mass Spectrometry (MS) of DNA 176 Supplementary Photon-driven Monitoring Methods 176 Novel Biological Monitoring Approaches 177 Conclusions and Future Prospects for GMO Detection by DNA Analysis 178 References 180

Contents

9 9.1 9.2 9.2.1 9.2.2 9.2.3 9.3 9.3.1 9.3.2 9.3.3 9.3.4 9.3.5 9.4 9.5 9.5.1 9.5.2

10 10.1 10.2 10.2.1 10.2.2 10.2.3 10.3 10.3.1 10.3.2 10.3.3 10.3.4 10.3.5 10.3.6 10.4

11.1 11.2 11.3 11.3.1 11.3.2

Genetic Engineering of Fish, and Methods of Detection 186 Hartmut Rehbein Introduction 186 Development and Production of Transgenic Fish 187 Structure of Gene Cassettes 189 Methods of Gene Transfer 189 Evidence of Gene Transfer and Expression 192 Examples of Successful Production of Transgenic Fish 193 Atlantic Salmon 193 Pacific Salmon 194 Tilapia (O. hornorum hybrid) 194 Tilapia (O. niloticum) 195 Carp (C. carpio) 195 Methods of Detecting Processed Transgenic Fish 196 Food Safety of Transgenic Fish 196 The Gene Product 197 Pleiotropic Effects 198 References 198 Detection Methods for Genetically Modified Crops Rolf Meyer Introduction 201 Isolation of plant DNA 202 Sampling 202 Sample Preparation 203 DNA Extraction and Analysis 204 Detection Strategies 205 Screening 206 Specific Detection 208 Example of Qualitative Detection 210 Quantification 210 Verification 211 Validation 212 Outlook, Conclusions 216 References 216

201

Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods 219 Karl-Heinz Engel, Francisco Moreano, and Alexandra Ehlert Introduction 219 Challenges Specific to the Detection of GMO in Composite and Processed Foods 220 Degradation of Proteins and DNA 221 Proteins 221 DNA 222

Contents

11.4 11.4.1 11.4.2 11.4.2.1 11.4.2.2 11.4.2.3 11.4.2.4 11.5

Analytical Methods 224 Protein-based Methods 224 DNA-based Methods 224 Qualitative PCR 225 Quantitative PCR 230 Competitive PCR 231 Real-time PCR 233 Conclusions 239 References 240

Mutations in Lactococcus lactis and their Detection 248 Jan Kok and Bertus van den Burg Summary 248 Introduction 248 The Composition of the Genome of Lactococcus lactis 249 Flexibility in the Genome of Lactococcus lactis 250 Conjugation 250 Transduction 251 Transformation 252 IS Elements and Transposons 252 Lactococcal Phages as Sources of Genetic Plasticity 253 An Example of Natural Genetic Flexibility: The L. lactis NCDO712 Family 254 Mutations in Lactococcus lactis as a Consequence of Environmental Factors and DNA Metabolism 254 Methods of Mutating the Genome of L. lactis 255 Genetic Engineering of Lactococcus lactis 256 Strategies for Detection of Genetically Modified Lactococcus lactis 259 Sample Preparation 259 DNA-based Procedures 260 Southern Hybridization 260 PCR 260 Qualitative PCR 261 Quantitative PCR (End-point and Real-time) 261 Exhaustive Limiting Dilution PCR 262 Nucleotide Sequence-based Procedures 262 Microarrays 262 Protein-based Procedures 263 Western Hybridization 263 ELISA 263 Protein Chips 264 Two-dimensional Gel Electrophoresis and Mass Spectrometry 264 Conclusions 265 References 266

12.1 12.2 12.3 12.4 12.5 12.6 12.7 12.8 12.9 12.10 12.11 12.12 12.13 12.14 12.15 12.15.1 12.15.2 12.15.3 12.15.4 12.15.5 12.15.6 12.15.7 12.16 12.16.1 12.16.2 12.16.3 12.16.4 12.17

XII

Contents

13.1 13.2 13.3 13.4 13.5 13.6

Methods for Detection of Genetically Modified Microorganisms used in Food Fermentation Processes 269 Walter P. Hammes, Christian Hertel, and Torsten Bauer Introduction 269 Current Methods for Detection of GMM 272 DNA Isolation 274 DNA Stability 275 Organism-specific Detection of the GMM 275 Conclusion 277 References 278 Index 281

Preface The first edition of this book was published in 2003. At that time one could not foresee its success, because admission of genetically engineered food into Europe had been suspended for several years. Since the lifting of the moratorium, however, applications, especially for admission of genetically engineered plants to be used as either food or feed, have again increased, showing that this is still a dynamic field of applied molecular biology. The era of molecular biology entered a new phase thirty years ago with the construction and successful transformation of the first recombinant DNA molecule (Cohen SN, Chang AC, Boyer HW, Helling RB. Construction of biologically functional bacterial plasmids in vitro. Proc Natl Acad Sci USA 1973; 70:3240–3244). This event marked the birth of genetic engineering which enabled very thorough analysis of cellular functions and provided the tool for targeted manipulation of the genetic material of cells and organisms. Supported by the development of the efficient chain-termination method for DNA sequence analysis (Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 1977; 74:5463–5467) and the polymerase chain reaction method for targeted amplification of DNA segments of choice (Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol. 1986; 51:263–273), genetic engineering of prokaryotic organisms and, later, of eukaryotes became a task easily performed in many laboratories. The potential of genetic engineering for food production was very soon recognized and the first genetically engineered food organisms, the famous “Flavr Savr” tomato with delayed ripening, was constructed and approved in the United States of America in 1994. Many other plants followed, for example rape, maize, and soy beans. The development of this new breeding technique initiated in Europe the introduction of new legislation needed for harmonization of legislation concerning free trade, for protection of public health and consumer rights, and for consideration of environmental aspects. This legislation has been as dynamic as the science behind genetic engineering – for example, the famous “Regulation (258/97/EC) concerning novel foods and novel food ingredients“ established only in 1997 was replaced by “Regulation (EC) No 1829/2003 on genetically modified food and feed” to encompass food produced with the aid of genetic engineering. To enforce this legislation, detection methods had to be developed enabling unambiguous identification of foods produced with

XIV

Preface

the aid of genetic engineering. Today, these methods must be capable of quantitative determination of amounts of genetically engineered ingredients at levels of 0.9% of the entire amount of the ingredient. This is necessary to guarantee that the accepted level of contamination of food with technically unavoidable genetically engineered material is not exceeded. Because of the success of the first edition of this book, we have used the same structure in the second edition. Current applications and future potentials of this breeding technique are discussed in Part 1. Part 2 covers the current state of legislation in Europe; the framework it sets for application of this technique is presented. Methods developed for detection of foods produced with the aid of genetic engineering are highlighted in Part 3. The book is by no means comprehensive. The focus of detection methods is clearly on detection of DNA. Issues of food safety and consumer acceptance are deliberately not dealt with. Whereas food safety is not a specific issue for novel foods but an issue for food in general, consumer acceptance of genetically modified foods is a very controversial topic of debate, and often the arguments in that debate are all but scientific. It is my feeling as editor that covering the consumeracceptance issue would obstruct consideration of the scientific data presented in the book. Last but not least, I wish to acknowledge the excellent cooperation of all the authors in updating their contributions to this second edition and to thank Waltraud Wuest, Wiley-VCH, for her support during the entire production phase of this edition. Knut J. Heller Kiel, June 2006

List of Contributors Torsten Bauer Institute of Food Technology University of Hohenheim 70593 Stuttgart Germany Gottfried Brem Institut of Animal Breeding and Genetics Veterinary University of Vienna Veterinärsplatz 1 1210 Vienna Austria Bertus van den Burg IMEnz Bioengineering B.V. L.J. Zielstraweg 1 9713 GX Groningen The Netherlands Alexandra Ehlert Technical University of Munich Center of Food and Life Sciences Chair of General Food Technology Am Forum 2 85350 Freising-Weihenstephan Germany Ralf Einspanier Institut für Veterinär-Biochemie Freie Universität Berlin Oertzenweg 19b 14167 Berlin Germany

Karl-Heinz Engel Technical University of Munich Center of Food and Life Sciences Chair of General Food Technology Am Forum 2 85350 Freising-Weihenstephan Germany Arnold Geis Institut für Mikrobiologie Bundesanstalt für Milchforschung Hermann-Weigmann-Str. 1 24103 Kiel Germany Walter P. Hammes Institute of Food Technology University of Hohenheim 70593 Stuttgart Germany Knut J. Heller Institut für Mikrobiologie Bundesanstalt für Milchforschung Hermann-Weigmann-Str. 1 24103 Kiel Germany Christian Hertel Institute of Food Technology University of Hohenheim 70593 Stuttgart Germany

XVI

List of Contributors

Carsten M. Hjort Novozymes A/S Krogshoejvej 36 2880 Bagsvaerd Denmark Jan Kalbheim Ludwig Maximilians Universität München Lehrstuhl für Öffentliches Recht und Europarecht Professor-Huber-Platz 2 80539 München Germany Jan Kok Department of Genetics Groningen Biomolecular Sciences and Biotechnology Institute University of Groningen Kerklaan 30 9751 NN Haren The Netherlands Georg Kristan Technische Universität FG Mikrobiologie und Genetik Gustav-Meier-Allee 25 13355 Berlin Germany Rena Leisegang Technische Universität FG Mikrobiologie und Genetik Gustav-Meier-Allee 25 13355 Berlin Germany Horst Lörz Biozentrum Klein-Flottbek Ohnhorststr. 18 22609 Hamburg Germany

Rolf Meyer Nestec Ltd Nestlé Product Technology Centre Orbe Quality Management Department 1350 Orbe Switzerland Francisco Moreano Bavarian Health and Food Safety Authority LGL Veterinärstr. 2 85764 Oberschleißheim Germany Elke Nevoigt Technische Universität FG Mikrobiologie und Genetik Gustav-Meier-Allee 25 13355 Berlin Germany Anke Niederhaus Technische Universität FG Mikrobiologie und Genetik Gustav-Meier-Allee 25 13355 Berlin Germany Hartmut Rehbein Institut für Fischereitechnik und Fischqualität Bundesforschungsanstalt für Fischerei Palmaille 9 22767 Hamburg Germany Anja Spielvogel Technische Universität FG Mikrobiologie und Genetik Gustav-Meier-Allee 25 13355 Berlin Germany

List of Contributors

Ulf Stahl Technische Universität FG Mikrobiologie und Genetik Gustav-Meier-Allee 25 13355 Berlin Germany Susanne Stirn Forschungsschwerpunkt Biotechnik Gesellschaft und Umwely (FSP BIOGUM) Universität Hamburg Ohnhorststr. 18 22609 Hamburg Germany

Rudolf Streinz Ludwig Maximilians Universität München Lehrstuhl für Öffentliches Recht und Europarecht Professor-Huber-Platz 2 80539 München Germany

XVII

Part I Application and Perspectives

1 Transgenic Modification of Production Traits in Farm Animals Gottfried Brem and Mathias Müller

1.1 Introduction

“Genetic engineering” is the umbrella term for procedures that result in a directed alteration in the genotype of an organism. The combined use of molecular genetics, DNA recombination and reproductive biology enables the generation of transgenic animals. For animals the term “transgenic” originally referred to the stable introduction of new genetic material into the germ line [1, 2]. This definition of transgenic animals has to be extended for two reasons. First, further developments in the genetic engineering of animals enable not only additive gene transfer (gain of function) but also deletive gene transfer (knock-out, loss of function), replacement gene transfer (knock-in, exchange of function), and spatial–temporal gene transfer (conditional knock-out) [3, 4]. Second, in addition to germ line integration of transgenes, somatic gene-transfer approaches result in (mostly transient) gene expression with the longest duration being a life span and no transmission of the transgenes to the progeny. Although somatic gene-transfer experiments in farm animals have been performed for production purposes [5, 6] this technology in animal production is more beneficial for the development of DNA-based vaccines [7]. Here we will mainly concentrate the discussion on germ line transgenic animals. The production of transgenic farm animals was first reported in the mid-1980s [8, 9]. The main progress in exploiting this technology has been made in the establishment of animal models for human diseases, production of heterologous proteins in animals (gene farming), and the production of organs for xenotransplantation [10–12]. In addition to these biomedical approaches research has focused on improvement of the efficiency and quality of animal production by transgenic means (this review and other work [13, 14]).

1.2 The Creation of Transgenic Animals

The main routes to transgenesis in mammals include: 1. microinjection of DNA into the pronucleus of a fertilized oocyte (zygote); 2. integration of a (retro)viral vector into an oocyte or an early embryo; 3. incorporation of genetically manipulated pluripotent stem cells into an early embryo; or 4. transfer of genetically altered nuclei into enucleated oocytes. For alternative gene transfer methods we refer to another review [15]. Spermmediated gene transfer, at least for pigs, has been proven to result in high-efficiency transgenesis ([16] and Refs. therein), although the method is not as broadly established as the methods described below. 1.2.1 Pronuclear DNA Microinjection

Microinjection of foreign DNA into pronuclei of zygotes is the classic method of gene transfer into farm animals. Since the first reports [8, 9] this technique, nearly unchanged, has accounted for most transgenic farm animals [15, 17]. DNA microinjection results in random integration of the foreign DNA into the host genome and is therefore not suitable for targeted modification of genomes. Although microinjections are performed at the one-cell-stage approximately 20–30% of the founder animals are mosaic and, therefore, may not transmit the integrated gene construct to their progeny [18]. Random integration of the gene constructs may cause alteration of one or more gene loci. Insertional mutagenesis is recessive and mostly characterized by a recombination event in the kilobase range at the transgene integration site. In mice approximately 5–15% are affected by this recessive mutation [19]. Except for studies in transgenic rabbits [20, 21], little has been published on analysis of hom*ozygous transgenic farm animals. This is mainly because of the long generation intervals. There is, however, no reason to doubt the mutagenesis frequencies estimated for mice in other transgenic mammals generated by the same technology. Random integration of the gene constructs may also result in varying, aberrant, or abolished transgene expression, because of effects of the adjacent chromatin overcoming the transgene’s regulatory sequences. One possible means of avoiding these integration site-dependent effects is the transfer of large DNA constructs, which can form functionally independent chromatin domains [22]. The first successful example for this strategy in livestock was the generation of transgenic rabbits harboring yeast artificial chromosomes (YACs) [23]. An alternative means of protecting transgenes from chromosomal position effects is the use of boundary elements (e.g. insulators, locus control regions, matrix attachment regions) in the gene constructs to achieve copy number-dependent and promoter-dependent and position-independent expression of transgenes [24]. Although success with this strategy has been reported, the effects of the elements were not always as expected.

1 Transgenic Modification of Production Traits in Farm Animals

Gene transfer efficiency (transgenic newborns and/or microinjected zygotes) is usually rather low, especially for large animals. One transgenic animal can be expected after microinjection of 40, 100, 90–110, and 1600 zygotes in mice, pigs, small ruminants, and cattle, respectively [25]. Differences in efficiency emphasize fundamental differences in the reproductive biology of species. Hence a high level of technical skills and experience in embryo collection and embryo transfer are critical for efficient transgenic production. This applies for all gene-transfer programs, however. As mentioned above, the procedures for generating large mammals by DNA microinjection have remained basically unchanged and little improvement in DNA-transfer efficiency has been achieved. After DNA microinjection, embryos are transferred to synchronized foster mothers. Great progress has been made in the field of embryo transfer. For all farm animal species embryo transfer has been facilitated by the development of endoscopy-guided minimally invasive techniques, reducing stress to the foster mothers and maximizing embryo survival and pregnancy rates [26–29]. Methods are currently being developed with the objective of improving the in-vitro production (IVP) of embryos [30, 31]. Endoscopic embryo transfer and IVP is also advantageous in the gene transfer methods discussed next. 1.2.2 Retroviral Vectors

The first germ-line transgenic mice were produced by retroviral infection of early embryos [32]. Retroviruses can be considered natural vehicles for gene delivery to mammalian cells. Endogenous retroviruses (ERVs) are a subset of retro-elements which represent up to 10% of the mammalian genome [33]. The capability of ERVs to reintegrate into the genome through reverse transcription mechanisms results in continuous insertion of new ERVs into the host genome. Until recently, retroviral vectors were not considered for farm-animal transgenesis, because of biosafety concerns and the dependence of most retroviruses on dividing cells for integration into the host genome. Retroviral gene transfer therefore often results in genetic mosaics when developing embryos are infected. With the development of replication-defective retroviral vectors mainly for gene-therapy purposes, a powerful tool for gene transfer in mammalian cells has been established [34]. To avoid mosaicism Chan et al. [35] inoculated bovine oocytes in the final stage of maturation with retroviral vectors. They achieved a remarkably high rate of transgenesis and, as expected, no mosaic transgenic cattle. A similar approach resulted in the generation of transgenic piglets [36]. One major limitation of retroviral vectors is their limited cloning capacity (<10 kb). Gene constructs, however, grow larger and larger to omit variegated transgene expression (see above). A second problem with many retroviral vector-mediated transgenesis relates to transcriptional shutdown of the transgenes [37]. Lentiviral vectors are a new generation of retroviral vectors which, in contrast with standard oncoretrovirus-based vectors, are reported to escape transcriptional silencing. In addition, lentiviruses are able to infect both dividing and

1.2 The Creation of Transgenic Animals

nondividing cells (reviews are available elsewhere [38, 39]). Germ-line transmission and expression of transgenes delivered by lentiviral vectors to one-cell mouse embryos has been reported [40]. Subsequently lentiviral gene transfer has been successfully used in swine [38, 39] and cattle [41]. This technique of transgenesis is more efficient and cost-effective, and technically less demanding, than pronuclear injection. The obstacle of the limited size of the constructs to be transferred remains, however. In the same way as for gene transfer by pronuclear injection, retrovirus-mediated gene transfer can only be used for additive gene transfer and also bears the danger of insertional mutagenesis. Analysis of transgene expression in lentiviral transgenic pigs revealed that, in contrast with early reports, some transgenics showed epigenetic silencing [42]. 1.2.3 Pluripotent Stem-cell Technology

Pluripotent stem cells are capable of developing into many cell types, including germ cells, on fusion with pro-implantation embryos (morulae, blastococysts). Pluripotent stem cells can be maintained in tissue culture and genetically manipulated and selected in vitro before reconstitution of the embryo. With mice, handling of pluripotent cells has become a routine method for targeted modification of the genome by hom*ologous recombination, i.e. deletive or replacement gene transfer [43]. Numerous efforts to establish pluripotent stem cells in species other than mice have so far failed. Possible reasons for this are discussed elsewhere (Refs [44, 45] and references cited therein). Since nuclear transfer using transgenic donor cells (see below) became an attractive alternative tool for targeted gene transfer, efforts to establish germ-line-competent stem cells from farm animals have been reduced. 1.2.4 Nuclear Transfer Using Transgenic Cells

Nuclear transfer technology – also known as cloning – comprises transfer of a donor nucleus (karyoplast) into the cytoplasm of an enucleated zygote or oocyte (cytoplast). Initial nuclear transfer experiments in farm animals used early embryonic stages as nuclear donors [46]. In breakthrough experiments with sheep it was demonstrated that in-vitro-cultured differentiated fetal cells and even cells derived from adult tissues could serve as nuclear donor for the reconstitution of enucleated oocytes [47, 48]. Cloning by nuclear transfer has subsequently been achieved in cattle [49–51], goats [52], pigs [53–55], rabbits [56], mules [57], horses [58], cats [59], dogs [60], and some wildlife species (a review is available elsewhere [61]). For farm animal transgenesis a novel tool has become available in that cultured cells can be genetically modified by conventional transfection methods before their use for nuclear transfer. The first reports on this novel gene transfer technique were the generation of transgenic sheep and cattle by nuclear transfer using transfected and selected fetal fibroblasts [62, 63]. Transgenesis by nuclear transfer of geneti-

1 Transgenic Modification of Production Traits in Farm Animals

cally modified cells has several advantages over the other additive gene transfer techniques: 1. mosaicism is avoided and germ-line transmission is guaranteed, because all cells of the cloned animal contain the transgene; 2. insertional mutagenesis and chromosomal positioning effects can be avoided, because integration and, eventually, transgene expression can be monitored in vitro; and 3. the use of male or female cell lines determines the gender of the transgenic animal. Most importantly, gene transfer by nuclear transfer provides a means of gene targeting in farm-animal species [64, 65]. Both the targeted disruption of genes by hom*ologous recombination (deletive gene transfer, knock-out) in sheep and pigs [66–68] and the targeted integration of a gene of interest into a given locus (replacement gene transfer, knock-in) [69] have been reported. The sequential targeting of both alleles of two genes has been achieved in cattle [70]. Despite these impressive reports and the intriguing advantages of the nuclear transfer technique for generation of transgenic farm animals, widespread use is not an easy task because: 1. the primary fibroblasts currently used for gene transfer have limited capacity to divide; 2. hom*ologous recombination is less frequent in somatic cells than in pluripotent stem cells; and 3. cloning by nuclear transfer has a low yield which is still diminished when nuclear donor cells are previously cultured [61]. There is also an ongoing debate about whether it is possible to overcome abnormalities observed in cloned animal [71, 72]. The abnormalities are not restricted to transgenic cloned animals, suggesting they originate from the nuclear transfer procedure or the in vitro culture conditions. Although healthy clones have been reported [73], improvement of the technology and further investigation of the effects of cloning are required [74].

1.3 Gene Transfer in Poultry

Depending on the developmental stage a variety of strategies are used for generation of transgenic birds, including DNA microinjection of fertilized ova, retroviral infection of blastodermal cells, and genetic manipulation of primordial germ cells (PGCs) or embryonic stem (ES) cells. In the same way as in mammals, the first method developed to transfer genes into birds was microinjection of DNA into the germinal disk of fertilized ova [75]. Although successful germ line transmission has been reported [76], the method is labor-intensive, ineffective, and frequently results in mosaicism. Retroviral vectors can introduce transgenes into the genome with low but acceptable efficiency. The first transgenic birds were produced using replication-competent vectors and thus could not be used for broad appli-

1.5 Transgenes – Gene Constructs

cation [77]. The development of replication-defective vectors led to wide use of this technique for production of transgenic birds and stable transgene expression [78, 79]. As an alternative, chimeras bearing transfected pluripotent cells originating from the blastoderm, from PGCs, or from ES cells have been reported (reviews are available elsewhere [80–82]).

1.4 Gene Transfer in Fish

The techniques for gene transfer into fish have focused on direct transfer of DNA into gametes or fertilized eggs and include DNA microinjection, electroporation, retroviral vector infection, and biolistic methods (Ref. [83] and references cited therein). Stem-cell-based technology is not available for farmed fish. The making of transgenic fish is different from gene transfer in mammals or birds because: 1. fish usually undergo external fertilization and no culture or transfer of eggs into recipient females is required; 2. the eggs of many fish have a tough chorion requiring special methods for delivering the gene constructs; and 3. DNA delivery, including by microinjection, is usually into the cytoplasm. Probably because of the cytoplasmic nature of DNA delivery, many founder transgenic fish are mosaic. Germ line mosaicism seems also to occur because frequencies of transgene transmission to F1 are clearly less than at Mendelian ratios. Transmission of the transgenes to later progeny occurs at Mendelian frequencies, indicating stable integration of the transgenes. A variety of inducible and targeted transgene strategies developed for mammals are now available to be tested and explored in fish (a review is available elsewhere [84]).

1.5 Transgenes – Gene Constructs

The exogenous DNA integrated into the host genome usually is referred to as the gene construct or transgene. The different transgenic sequences used for the different gene-delivery methods and gene-transfer programs are summarized in Table 1.1. For additive gene transfer experiments the gene construct encompasses the elements controlling gene expression (5 promoter region, 3 control regions) and the sequences (cDNA, genomic DNA) encoding the transgene product. For DNA microinjection or sperm-mediated gene transfer the prokaryotic cloning vector sequences are removed from the gene construct. Prokaryotic sequences – especially their CpG dinucleotide base pairs – may undergo methylation or heterochromatin formation in animal cells, which leads to transgene silencing. It is becoming increasingly clear that silenced transgenes have been recognized as foreign elements by host cellular mechanisms, as have retroviral and transposon sequences [85, 86].

RNAi expression construct

Unwanted sequences may be removed in vitro by site-specific recombinases

Pronuclear DNA microinjection; sperm-mediated; physical and/or chemical methods; retroviral vectors

Selectable marker genes*

Reduction of function by RNAi

• Introduction of novel allelic variants • exchange of coding sequences in a transcription unit

Selectable marker genes*

Cloning by transfer of genetically modified nuclei

Selectable marker genes*

Cloning by transfer of genetically modified nuclei

Exchange of function

Deleted or non-sense-mutated species-specific sequences

Viral sequences

Retroviral vector

Cloning by transfer of genetically modified nuclei

See above

Chromosomal elements

Artificial mammalian chromosomes

Loss of function

See above

PAC-, BAC-, YAC-vector elements

Artificial nonmammalian chromosomes

RNAi expression construct gene(s)

See above

• Species-specific sequences • cross-species sequences • new combination of promoter and coding sequences (speciesspecific or cross-species)

–

Pronuclear DNA microinjection; sperm-mediated; physical and/or chemical methods

Composition and origin of the transgene

Gain of function

Sequences not related to the transgene per se

Methods of gene transfer

Functional consequence of gene transfer

Tab. 1.1 Characteristics of the transgenes used for different gene-delivery methods and gene-transfer programs in farm animals.

Specific “knock-down” of target

• Targeted alteration of milk protein genes • replacement of genes

Generation of PrPc gene-deficient ruminants

See above

• Additional copies of casein alleles • humanized milk • mammary gland-specific expression of antibodies

Example (see below)

1 Transgenic Modification of Production Traits in Farm Animals 9

1.5 Transgenes – Gene Constructs

As mentioned above, one obvious way of avoiding transgene silencing or chromosomal positioning effects would be the use of large gene constructs and the abandoning of viral vectors. An increasing number of transgenic animals therefore carry gene constructs based on phage (PAC), bacterial (BAC), or yeast (YAC) artificial chromosomes [22]. For expression and replication, these large transgenes depend on integration into the host genome. In contrast, mammalian artificial chromosomes (MACs) provide independent transcription and replication units. Work originating mainly from human gene therapy programs has resulted in the development of human artificial chromosomes based on episomal viral vectors or engineered minimal chromosomal elements [87, 88]. MACs were recently used to generate “transchromosomic” cattle; this was achieved by introducing human artificial chromosomes in vitro into bovine cells which were subsequently used for cloning by nucleus transfer [89, 90]. Alternatively, gene transfer in vitro then reconstitution of embryos by nuclear transfer or stem-cell technology enables targeting of transcription units in the host genome or in-vitro analysis of the chromosomal integration site. These genetransfer techniques, however, require methods for the identification of the genetically modified cells. Identification of transgenic cells is mostly based on (drug) selectable markers, e.g. antibiotic-resistance genes, added to the gene constructs. In plants the presence of marker genes in the genetically modified organism is a topic of concern about biosafety [91]. Analogous a genetically modified farm animal going on the market should be free from such genes. This can be achieved by use of site-specific recombinases to remove undesirable sequences after successful identification of the transgenic cells [92, 93]. Additional methods for site-directed genome modification are reviewed elsewhere [94, 95]. It must, however, be mentioned that these additional genetic engineering steps have not yet been conducted in farm animals. RNA interference (RNAi) is the process in which dsRNA leads to gene silencing, by either inducing the sequence-specific degradation of complementary mRNA or inhibiting translation. RNAi has been very successfully applied as gene-silencing technology in both plants and invertebrates, but many practical obstacles need to be overcome before it becomes a versatile tool in mammalian cells. Greater specificity and efficiency of RNAi in mammals is being achieved by improving the design and selection of small interfering RNAs (siRNAs), by increasing the efficacy of their delivery to cells and organisms, and by engineering their conditional expression (reviews are available elsewhere [4, 96, 97]). The power of this technology in transgenic animals has been demonstrated by production of mice constitutively expressing RNAi directed against a given transcript which show a similar phenotype as mice with hom*ologous targeted disruption of the locus [98]. Retroviral vector-mediated gene transfer methods have the advantage of the transgene being actively delivered to the cells and integrated into the host genome. The disadvantage of the system is the above mentioned transcriptional shutdown and heterochromatin formation of the transgenes, because of the presence of the viral sequences.

1 Transgenic Modification of Production Traits in Farm Animals

1.6 Transgenic Animals with Agricultural Traits

A key element of the enhanced production of domesticated species is the development of genetically superior breeding stocks tailored to their maintenance conditions and to the marketplace. Characteristics that are generally desirable in all species include improvement of growth rates, feed conversion efficiency, disease resistance, and a capacity to utilize low-cost or nonanimal protein diets. Attempts to improve productivity traits in farm animals by transgenesis can be divided into products designed for consumers’ consumption per se and traits not affecting the food chain in the first place. The first topic includes stimulation of growth rates, food conversion, and alteration of carcass and milk composition. The second aims at improvement of fiber products, enhanced disease resistance, and introduction of novel biochemical pathways. Although the transgene product in this field is not meant for food, the meat or milk of the genetically modified animal could be considered for consumption (reviews are available elsewhere [11, 14, 99]). At the outset it should be noted that progress on manipulation of agricultural animal traits is far slower than originally envisaged in the early days of transgene technology. First, this is because the most economically important traits are controlled by multiple genes, which are still largely unknown and hence not amendable to manipulation. Even after identification of all genes contributing to a complex trait, genetic engineering of this trait would require multiple gene transfers. Second, the low efficiency of gene transfer in farm animals (see above) makes research on transgenesis quite costly. Third, the ability to regulate expression of transgenes is still far from adequate (see above). Finally, public acceptance of genetically modified organisms in the food chain – at least in Europe – has not yet been achieved. Compared with mammals and fish gene-transfer experiments in chickens are still limited. The objectives of gene transfer in poultry are basically identically with those for other farm animals (reviews are available elsewhere [100, 101]).

1.7 Improved Growth Rate, Carcass Composition, and Feed Efficiency 1.7.1 Transgenic Mammalian Farm Animals

Among the genetically determined factors regulating growth rate and feed conversion the genes encoding polypeptides of the growth-hormone cascade are of particular interest. The positively acting growth hormone-releasing hormone (GHRH, somatoliberin) and its antagonist somatotropin release-inhibiting factor (SRIF, somatostatin) control the production of growth hormone (GH, somatotropic hormone (STH), somatotropin). The action of GH is very dependent on the metabolic state of the organism – low blood glucose levels result in catabolic effects (lipolysis)

1.7 Improved Growth Rate, Carcass Composition, and Feed Efficiency

and a positive energy balance causes anabolic effects which are mainly governed by insulin-like growth factor 1 (IGF-1, somatomedin C). The original workers on farmanimal transgenesis was impressed by the results of Palmiter et al. [102] which indicated that mice expressing excess GH grew much faster and bigger than nontransgenic control mice. Several GH transgenic pigs and sheep have been produced with human, bovine, ovine, porcine, or rat GH, under the control of several promoters (a review is available elsewhere [14]). GH-transgenic pigs expressing the gene constructs at high levels were found to have faster growth rates and increased feed efficiency. The most dramatic effect of elevated GH levels in pigs was reduction of carcass fat as transgenic pigs approached market weight [13, 103]. It was found, however, that constitutive and/or high level expression of GH in pigs had a variety of pathological side-effects [104, 105]. Transgenic ruminants (cattle, sheep, goats) carrying growth-promoting genes have been also generated but no positive effects on growth performance or carcass composition were reported (a review is available elsewhere [14]). Attempts to affect carcass composition in respect of beneficial dietary properties for human consumption are, nevertheless, of high priority for the meat-production industry (Section 1.10, below and Ref. [106]). It was recognized that tight regulation of transgene expression would be required to avoid deleterious effects from continuous exposure of mammals to elevated GH. So far, most attempts to use dietary inducible promoters have failed. Two studies reported the production of growth-promoting transgenic pig lines. A metal ion-inducible promoter linked to the porcine GH gene was introduced into pigs and many transgenic founder animals were produced. Transgenic pigs were tested for metal-induced transgene expression and animals with high basal levels of transgene expression or plasma GH levels outside the range of non-transgenics were excluded from the study. By following this strategy negative side-effects could be avoided [107]. Because of the random integration of the transgenes as a result of DNA microinjection and the lack of shielding sequences, however, the transgenic lines had a high level of variegated gene expression. In a second study the expression of IGF-1 was directed to muscle by using a skeletal muscle-specific expression cassette. By avoiding the systemic effects of GH increased carcass leanness was achieved with no detrimental side-effects [108]. Interestingly, in the context of the use of growth hormone cascade transgenes, somatic gene-transfer might satisfy demands for improved growth performance. A somatic gene-transfer procedure employing a singular intramuscular injection and electroporation of muscle-specific expression vectors encoding a protease-resistant GHRH resulted in elevated GH and IGF-1 levels which, in turn, augmented long-term growth without pathological side-effects [6]. An alternative means of altering the growth performance involves the differentiation process of muscle cells themselves. For example, the chicken c-ski proto-oncogene was found to induce myogenic differentiation. This muscle differentiation gene was introduced into cattle [109]. As observed with the growth hormone cascade genes, no effects or mainly deleterious effects of the transgene expression were reported, however. Myostatin, also known as growth and differentiation factor 8, negatively regulates skeletal muscle development. Deletion or

1 Transgenic Modification of Production Traits in Farm Animals

non-sense mutations in the myostatin gene are responsible for double muscling in cattle (a review is available elsewhere [110]). Myostatin-deficient mice, generated by gene targeting, produced twice the muscle mass with reduced carcass fatness as wild type mice, mirroring the phenotype of myostatin mutant cattle [111]. In an additive gene transfer experiment it was shown that expression of a dominantnegative myostatin transgene also led to increased muscle development, growth performance, and carcass weight [112]. By use of a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, transgenic mice were generated which express a dominant-negative myostatin propeptide under control of a muscle and in a Y-chromosome-specific manner. Transgenic males were characterized by a 5–20% increase in skeletal muscle mass. This experiment demonstrates the feasibility of a more efficient cattle production system combining superior beef production for bulls and dairy output for cows [113]. The myostatin gene is therefore an attractive candidate for both gene targeting and gain of function experiments in farm animals [110]. 1.7.2 Transgenic Fish

Aquaculture is still in its infancy compared with the farming of mammals or poultry. Growth rates of the many fish species used are naturally slow but are currently being enhanced by traditional methods of domestication and selection. Programs for growth-promoting gene-transfer into fish usually use GH-based gene constructs [83]. Because of the lack of available piscine sequences, the first experiments were conducted with mammalian GH gene constructs. The effects on growth performance were, however, either not detectable or very small. Gene transfer using fish GH sequences driven by nonpiscine promoters has resulted in growth stimulatory effects in transgenic carp, catfish, and tilapia; weight increases were approximately twice those of controls. These experiments provided the first consistent data demonstrating that growth acceleration in fish can be achieved by transgenesis [83]. Subsequent use of all-piscine gene constructs produced fish with up to fortyfold elevated circulating GH levels and five- to elevenfold increased weight after one year of growth [114, 115]. Pleiotropic effects in the GH-transgenic fish included altered body composition (50% reduced fat levels), unpredictable variations in food consumption and conversion, and some pathological side-effects. Comparative gene-transfer programs demonstrated that GH-transgenes dramatically enhanced the growth of wild but not domesticated fish [116]. Thus in domesticated and selected farm animal species the capacity for further growth enhancement by GH may be restricted by limitations in other physiological pathways. In mammals this is reflected by dramatic growth stimulation in GH-transgenic mice but not in domestic livestock that have undergone many centuries of genetic selection (see above). Genetically engineered fish with enhanced phenotypic traits have yet to be implemented in commercial applications. In addition to the technical issues described, this is partly because of the difficulties in reliably predicting the ecological risk of transgenic fish should they escape into the wild. The ecological

1.8 Alteration of the Composition of Milk

consequences of the phenotypic differences between transgenic and wild-type fish, as determined in the laboratory, can be uncertain, because of genotype-by-environment effects. These biosafety issues are reviewed elsewhere [117]. Salmonids are fish of high economic value which are unable to survive in waters characterized by ice and subzero temperatures. Antifreeze proteins (AFP) are produced by several fish that inhabit extremely cold waters. One possible way of solving the problem of overwintering salmon in sea cages in the northern hemisphere is the transfer of antifreeze protein genes. The AFP-transgenic salmons produced so far express the transgene at levels insufficient to confer freeze resistance (a review is available elsewhere [83]).

1.8 Alteration of the Composition of Milk

Potential changes in milk composition or in the primary structures of milk proteins, and their presumed beneficial effects on the nutritional, physiochemical, and technological properties of milk and milk products have already been reviewed extensively [14, 118]. It should be noted that most transgenic strategies are at the stage of being tested by use of mouse models and gene-transfer technology for improvement of milk quality is far from commercial application. Attempts to improve the processing properties of milk include changing the casein content and the introduction of modified milk proteins. To enhance milk composition and milk processing efficiency by increasing the casein concentration in milk, cloning by transgenic female nucleus transfer was used to generate transgenic cows carrying additional copies of bovine beta-casein and kappa-casein genes. Analysis of the hormonally induced milk revealed substantial expression and secretion of the transgenederived caseins into milk. These results show it is feasible to substantially alter a major component of milk in high-producing dairy cows by a transgenic approach and thus to improve the functional properties of dairy milk [119]. Introduction of human milk protein genes or replacement of bovine genes by human genes may play an important role in the production of surrogates for human milk. Bovine and human milk differ substantially and, therefore, cows’ milk is not an ideal source of food for babies. Bovine milk can be humanized by increasing the whey protein content, e.g. by expressing the antimicrobial proteins lactoferrin and lysozyme [120, 121]. Large-scale production of human lactoferrin in the milk of transgenic cows has recently been reported [122]. The structure of the transgenic protein was reported to match that of human origin [123]. Beta-lactoglobulin is the major heat-labile whey protein of ruminant milk and does not occur in human milk. Although beta-lactoglobulin is not the only bovine milk protein with allergenic properties it is widely assumed that milk depleted of this protein would be a better source of humanized milk. In principle, the technology for gene knock-out in ruminants is now available. Depletion of particular proteins from the milk has been performed in mice for beta-casein [124] and alpha-lactalbumin

1 Transgenic Modification of Production Traits in Farm Animals

[125, 126]. Whereas beta-casein was found to be a non-essential component of the milk protein system, knock-out of alpha-lactalbumin resulted in disruption of lactation and lactose synthesis. Because the biological function of beta-lactoglobulin and its contribution to bovine milk physiology are not known, the side-effects of a knock-out approach cannot be predicted. RNAi technology – once established in farm animals – will be useful for determining the biology of these proteins and potentially down-regulating their expression. Tab. 1.2 Proposed modifications of milk composition.

Target gene

Gene transfer

Transgene effect

Overall effect

alpha- and beta-Caseins Gain of function

Improved cheese-making properties, increased Ca2+ content

Improved technical processing

kappa-Casein

Gain of function

Improved heat stability, reduced micelle size, reduced coagulation

Improved technical processing

Novel phosphorylation and proteolytic sites in caseins

Exchange of function

Increased Ca2+ content, improved cheese ripening

Improved technical processing

beta-Lactoblobulin

Loss of function

Increased temperature sta- Improved technical bility, improved digestibility, processing and/or humanized milk reduced allergenicity

Human lysozyme

Gain of function

Antimicrobial, increased cheese yield

Improved technical processing and/or humanized milk

Human lactoferrin

Gain of function

Antimicrobial

Humanized milk

alpha-Lactalbumin

Reduction of function

Reduced lactose

Improved nutritional value

Lactase

Gain of function

Reduced lactose

Improved nutritional value

Acetyl CoA carboxylase

Reduction of function

Reduced fat content

Improved nutritional value

Immunoglobulin genes Gain of function

Passive oral immunization

Nutraceutical

Antigen genes

Gain of function

Active oral immunization

Nutraceutical

Phe-free alpha-lacta bumin

Exchange of function

Source of amino acids for patients suffering from phenylketonuria

Nutraceutical

Stearoyl-CoA desaturase

Gain of function

Fatty acid pattern of benefit to cardiovascular health

Nutraceutical

1.9 Improved Animal Health

Lactose is the major sugar present in milk and is synthesized by the lactose synthase complex comprising a galactosyltransferase and alpha-lactalbumin. Most of the adult population suffers from intestinal disorders as a consequence of lactose maldigestion that results from physiological downregulation, at weaning, of the intestinal lactose-hydrolyzing enzyme. Low-lactose milk in vivo has been generated by partial inhibition of the alpha-lactalbumin gene by an RNA-antisense approach [127] and by the mammary gland-specific expression of an intestinal lactase [128]. Milk seems to be an ideal vehicle for development of nutraceuticals, i.e. dietary supplements and functional and medical food [129]. Examples of the use of milk as a nutraceutical are listed in Table 1.2. The enzyme stearoyl-CoA desaturase converts specific medium-chain and longchain saturated fatty acids into their monounsaturated forms. Transgenic goats expressing this enzyme in the mammary gland produce milk in which the fat has a less saturated and more monounsaturated fatty acid profile at some stages of lactation. Milk containing higher proportions of monounsaturated fatty acids and conjugated linoleic acid may benefit human cardiovascular health [130]. Bovine alpha-lactablumin gene transgenic pigs have been generated in an attempt to increase milk production and lactose content for the benefit of suckling offspring. Enhanced lactation performance and, consequently, enhanced litter growth performance were observed (a review is available elsewhere [131]).

1.9 Improved Animal Health

In contrast with selection for production performance, attempts to select for improved disease resistance by conventional breeding programs have not been successful. Reduction of the susceptibility of livestock to disease will be of benefit to animal welfare and will also be of economic importance. Improved health status in animal production results in improved production and reproduction performance. Both somatic and germ-line gene transfer can be used. To introduce new diseaseresistance traits to farm animals, germ-line transmission is required. Strategies for enhancing disease resistance by transgenesis have been extensively reviewed elsewhere [14, 132, 133]. Somatic gene transfer mainly focuses on DNA vaccines (genetic immunization, see above). Integration, stable germ-line transmission, and, occasionally, expression of gene constructs designed to confer disease resistance have been demonstrated. The final proof of successful generation of resistant farm animals, i.e. challenge with an infectious pathogen, has not, however, been reported until recently. In a breakthrough experiment, genetically engineered cows were shown to have enhanced resistance to mastitis [134]; reviews are available elsewhere [99, 135].

1 Transgenic Modification of Production Traits in Farm Animals

1.9.1 Additive Gene Transfer of Resistance Genes

The term “intracellular immunization” was originally used to denote the overexpression in the host of an aberrant form (dominant-negative mutant) of a viral protein that can interfere severely with replication of the wild type virus. This definition has since been extended to all approaches based on intracellular expression of transgene products which inhibit the replication of pathogens in host organisms (Ref. [133] and references cited therein). Initial studies with farm animals included the “classical” approach of overexpression of a viral protein in transgenic sheep [136], transgenic rabbits expressing antisense constructs complementary to adenovirus RNA [137], and the transfer of the specific disease resistance gene Mx1 of mice into swine [138]. The mouse Mx1 gene is one of the few examples of a single genetic locus encoding a disease resistance trait. Mice carrying the autosomal dominant Mx1 allele are resistant to influenza viruses and transfer of the Mx1 gene into susceptible mice that lacked the Mx1 allele was sufficient to restore virus resistance [139]. Swine are susceptible to influenza and provide a substantial reservoir for swine influenza viruses. Different gene constructs containing the mouse Mx1 cDNA controlled by two constitutive promoters and the inducible murine Mx1 promoter were transferred into swine. Constitutive Mx1 expression was found to be detrimental to the organism and the inducible Mx1 construct responded to stimuli by RNA synthesis, although at levels insufficient to produce detectable amounts of Mx1 protein. This again emphasizes the importance of tight transgene regulation to a positive outcome from gene-transfer experiments [138]. “Congenital immunization” is defined as transgenic expression and germ-line transmission of a gene encoding an immunoglobulin specific for a pathogen and therefore providing congenital immunity without prior exposure to that pathogen. The approach was tested in farm animals by expressing the gene constructs encoding mouse monoclonal antibodies in transgenic rabbits, pigs, and sheep [140, 141]. Both experiments resulted in transgene expression but revealed also some unexpected findings, e.g. aberrant sizes of the transgenic antibody or little antigen-binding capacity. Following this idea, preformed antibodies against a virus causing a neonatal disease were expressed in the mammary gland of mice. Transferred to farm animals this could improve the protection of suckling offspring by use of colostral-delivered antibodies [142]. It remains to be investigated, however, whether the efforts required to optimize the concept of “congenital immunization” are justified by its benefits in terms of increasing disease resistance in a particular species. When following this route one has must also remember that a given infectious pathogen will be readily able to escape the transgenic animal’s immunity by changing its antigenic determinants. Transfer of antibody-encoding genes into farm animals is, in general, of great importance for production of therapeutic antibodies for human medicine (Refs [90, 143] and references cited therein). “Extracellular immunization” refers to transgene products with extracellular antipathogenic function. This strategy includes the systemic or local expression of immunomodulatory cytokines and pathogen defense molecules of the innate

1.9 Improved Animal Health

immune system [132]. Peptide-based antimicrobial defense is an evolutionarily ancient mechanism of host response found in a wide range of animals from insects to mammals. The small lytic peptides interact with lipid bilayer membranes to cause osmotic disruption and cell death. Bacterial, protozoan, fungal, and damaged eukaryotic cells are most susceptible to disruption [144]. Experiments with transgenic mice and fish have revealed the power of overexpressing antimicrobial peptides in generating enhanced resistance of the animals against invading microbes [145–147]. Lysostaphin is a potent bacterial peptidoglycan hydrolase with specific bactericidal activity against Staphylococcus aureus, the major contagious mastitis pathogen. Mammary gland-specific expression of lyostaphin could therefore enable production of mastitis-resistant cows and reduce the major economic burden of the dairy industry. Proof of principle of mammary gland-expressed lysostaphin conferring protection against stapylococcal infection has been obtained for mice [148]. By use of gene transfer via cloning by nuclear transfer this concept was successfully extended to cows [134]. Transgenic mice expressing a soluble form of a protein known as herpesvirus entry mediator were generated. The transgenic mice had nearly complete resistance to challenge with the alpha-herpesvirus, suggesting the potential of the approach for generating pseudorabies-resistant livestock [149]. 1.9.2 Gene Targeting of Susceptibility Genes

Another potential means of improving disease resistance is the removal of disease susceptibility genes by hom*ologous recombination to create null alleles or to replace a disease allele by a resistance allele [14]. This concept is discussed for generation of cattle and sheep resistant to spongiform encephalopathies caused by infectious prion particles. Mice devoid of the endogenous prion protein PrPc cannot be infected with the infectious particles and the loss of function mice now have gross abnormalities [150]. Targeted inactivation of the gene encoding PrPc in cattle and sheep might therefore create BSE or scrapie-resistant animals. Successful targeting of the PrP locus in sheep and bovine fetal fibroblasts for use of nuclear transfer has been reported, and living PrP-deficient sheep and cattle are to be obtained [67, 70]. The physiological role of the endogenous prion protein and the genetic components of susceptibility to the disease are still largely unknown. (More information is available elsewhere [151, 152]). Future experiments will show whether fundamental differences between mice and ruminants will prevent the generation of such loss of function animals. An attractive alternative to gene targeting by hom*ologous recombination is provided by RNAi technology which, in future, should enable modulation or downregulation of the genes involved in disease processes (see the discussion above and Ref. [153]).

1 Transgenic Modification of Production Traits in Farm Animals

1.10 Improved Biochemical Pathways

Transgenesis enables the transfer of genetic information across species barriers. Combined with functional promoter elements, nonmammalian genes can be expressed in farm animals to modify intermediary metabolism. To address the problem of environmental pollution with manure in pig production, transgenic pigs were produced which express the Escherichia coli phytase gene in the salivary gland. Consequently, the transgenic pigs can digest the phosphorus in phytate, the most abundant source of phosphorus in the pig diet, and so fecal phosphorus excretion by transgenic pigs is substantially reduced [154]. “Phosphorus-friendly” pigs contributing to solution of a common form of environmental problem might also help overcome public skepticism toward transgenic livestock (see below and Ref. [155]). The introduction of new biochemical pathways to increase the availability of specific nutrients that are currently rate-limiting in animal production is a challenging task. Research programs on transferring prokaryotic genes to ruminants to introduce cysteine, threonine, and lysine biosynthesis or a functional glyoxylate cycle (for conversion of the major rumen metabolite acetate to glucose) have so far failed [156]. The first example of a plant gene expressed in a complex mammalian system was provided by Saeki et al. [157]. The work of the group is part of an international effort to improve pig meat quality (carcass composition, see also above). A fatty acids desaturase gene from spinach, functionally expressed in pigs, led to an significant increase of polyunsaturated fatty acids in pork. This success may pave the way toward production of healthier porcine meat and to diversification of the range of products available from livestock [106, 157].

1.11 Improved Wool Production

Improvement of wool production by transgenesis can be achieved by generating an abundant supply of the cysteine required for keratin synthesis. Keratins are the major structural proteins of wool fibers and cysteine is the rate-limiting amino acid in wool production. Dietary addition of cysteine does not increase wool production because of digestive degradation of the compound. When bacterial cysteine biosynthesis genes were transferred into sheep, however, improved wool growth was not observed, because transgene regulation was not adequate to integrate the novel pathway into the existing biochemical homeostasis [158]. The second attempt at improving wool quality was directed at modification of the protein composition of the wool fiber. The gene encoding the wool intermediate filament keratin was overexpressed in transgenic sheep and alteration of the fiber ultrastructure was observed. The changes did not have a positive effect on the processing quality of the wool [159]. Further investigations are in progress, using

1.12 Transgenic Farm Animals Biosafety Issues, Animal Welfare, and Ethics

transgenes encoding keratins rich in the amino acids which have a positive effect on wool quality [160]. The third approach used to improve wool production is the targeted overexpression of growth factors (EGF, IGF-1) in wool follicles or skin [161, 162]. So far, none of the approaches has resulted in a novel transgenic breed with improved wool production traits.

1.12 Transgenic Farm Animals, Biosafety Issues, Animal Welfare, and Ethics

The biosafety of transgenics concerns the consumer and affects the environment and the transgenic animals. Evaluation of the food safety of transgenic animal products (novel food, nutraceuticals) is handled by national and international authorities (a review is available elsewhere [129]). Theoretically, meat or milk from transgenic farm animals generated for nonfood purposes could also be consumed. For example, the transgene in the “phosphorus-friendly” pig is expressed exclusively in the salivary gland; the meat, therefore, contains only the transgene DNA not the transgene product. For consumers’ safety, the risk of toxicity and of transfer of the ingested transgenes must be assessed. DNA is an essential part of nutrition and is not usually toxic upon uptake through the digestive tract. Large alimentary DNA fragments seem to survive gastrointestinal passage, enter the blood stream, and can be found in the nuclei of a variety of types of cell [163]. It is obvious, however, that this does not lead to vertical gene transfer and there is no reason why a transgene should integrate into a consumer’s genome preferentially compared with nonrecombinant DNA. Nevertheless, especially with regard to the relevance and frequency of transfer of selectable DNA sequences from genetically modified plants in the gut of mammals to bacteria the debate is still ongoing (Ref. [164] and references cited therein). The biorisks resulting from transgenesis in farm animals depend on the animal species, the method of gene transfer, the nature of the transgene, and the fate of the transgenics. Genetically modified organisms are not allowed to multiply uncontrolled in the environment. Large farm animals have little opportunity to escape and no chance of crossing with wild animals. More concern is warranted over possible escape of transgenic growth-enhanced fish from cage culture with access to free waters [165] and subsequent spread of the transgene into the natural population [166]. The fish in such cages must therefore be rendered sterile or they must be kept in artificial containment facilities. Physiochemical gene-transfer methods and cloning by nuclear transfer do not have intrinsic biorisks, because the DNA is stably integrated into the host genome. Viral vectors are generally liable to the risk of recombination with wildtype viruses that in turn might create the means to spread the transgene.

1 Transgenic Modification of Production Traits in Farm Animals

The major biorisks arising from transgenes are to the animals themselves (see below). All transferred DNA fragments should be characterized by sequencing. This may be not always be possible, however, especially for large gene constructs, for example artificial chromosomes. Transgenic animals designed for human consumption will be devoid of marker genes and other sequences not required for transgene function. Methods for the removal of such sequences are available (see above). A transgenic founder animal has, a priori, unknown biological properties and must be tested for stable integration and transmission of the transgene. The F1 generation can be tested for stable and promoter-specific, i.e. nonectopic expression of the transgene. hom*ozygous animals are produced to prove the freedom of insertional mutagenesis. It is obvious that before use of the transgenic animal for production purposes wanted and possible unwanted transgene effects are thoroughly checked by laboratory and veterinarian methods. Programs for the systematic assessment of risks associated with transgenic farm animal welfare and breeding have been developed and must be applied rigorously [167]. Environmental issues and animal welfare are the most serious public concerns about animal biotechnology. Scientific uncertainty often hinders good risk assessment of animal biotechnology. Ethical assessments must openly address these uncertainties, with the precautionary principle providing a good criterion for responsible policies. A practical method for ethical assessment of animal biotechnology has been proposed [168].

1.13 Conclusion

Gene-transfer technology enables the direct introduction of novel traits into farm animals. The biological performance of the transgene in the animal can be measured in a few generations. Breeding success can be achieved in a shorter time compared with classical breeding programs. Gene transfer can, however, be only performed in a limited number of animals. When a positive biological outcome of the artificially added or altered allele in the founder animal’s offspring is established, the novel trait has to be spread in the production population by conventional strategies. So far no genetically engineered food from farm animals has been made available commercially. This is because of the above mentioned difficulties in the generation of transgenic farm animals, the frequent failure to transfer the proof of principle success in basic research models to farm animals, and the lack of public acceptance of novel food. The reasons for this lack of acceptance, and the ethics of transgenics are discussed elsewhere [168, 169]. Farm animal transgenics is undoubtedly important for biomedicine. Even if public perception moved in favor of transgenic food and if optimized gene-transfer technology increased efficiency in the generation and exploitation of transgenics, most livestock-derived products would still be for niche markets only, mainly because of limitations in the dissemination of the transgene (introgression).

References

Farm animal transgenics, farm animal reproductive biotechnology, and farm animal genomics have developed in parallel [170–173]. These three important aspects of the technology will develop further in the years to come and the tools, taken together, will eventually lead to genetically modified farm animals that meet the demands of productivity and biosafety.

References 1 Gordon, J.W., F.H. Ruddle, Science 1981, 214, 1244-1246. 2 Gordon, J.W., G.A. Scangos, D.J. Plotkin, J.A. Barbosa, F.H. Ruddle, Proc. Natl. Acad. Sci.U S A 1980, 77, 7380-7384. 3 Clark, J., B. Whitelaw, Nat. Rev. Genet. 2003, 4, 825-833. 4 Ristevski, S., Mol. Biotechnol. 2005, 29, 153-164. 5 Düchler, M., M. Pengg, S. Schüller, F. Pfneisl, C. Bugingo, G. Brem, E. Wagner, K. Schellande, M. Müller, J. Gene Med. 2002, 4, 282-291. 6 Draghia-Akli, R., M.L. Fiorotto, L.A. Hill, P.B. Malone, D.R. Deaver, R.J. Schwartz, Nat. Biotechnol. 1999, 17, 1179-1183. 7 Dunham, S.P., Res. Vet. Sci. 2002, 73, 9-16. 8 Hammer, R.E., V.G. Pursel, C.E. Rexroad Jr., R.J. Wall, R.D. Palmiter, R.L. Brinster, Nature 1985, 315, 680-683. 9 Brem, G., B. Brenig, H.M. Goodman, R.C. Selden, F. Graf, B. Kruff, K. Springman, J. Hondele, J. Meyer, E.-L. Winnacker, H. Kräußlich, Reprod. Dom. Anim. 1985, 20, 251-252. 10 Keefer, C.L., Anim. Reprod. Sci. 2004, 82-83, 5-12. 11 Kues, W.A., H. Niemann, Trends Biotechnol. 2004, 22, 286-294. 12 Houdebine, L.M., Reprod. Domest. Anim. 2005, 40, 269-281. 13 Pursel, V.G., C.A. Pinkert, K.F. Miller, D.J. Bolt, R.G. Campbell, R.D. Palmiter, R.L. Brinster, R.E. Hammer, Science 1989, 244, 1281-1288. 14 Wheeler, M.B., E.M. Walters, S.G. Clark, Anim. Reprod. Sci. 2003, 79, 265-289. 15 Wall, R.J., Theriogenology 2002, 57, 189-201. 16 Webster, N.L., M. Forni, M.L. Bacci, R. Giovannoni, R. Razzini, P. Fantinati, A. Zannoni, L. Fusetti, L. Dalpra, M.R. Bianco, M. Papa, E. Seren, M.S. Sandrin,

17 18

19 20

22 23

24 25 26 27 28

29 30

I.F. Mc Kenzie, M. Lavitrano, Mol. Reprod. Dev. 2005, 72, 68-76. Houdebine, L.M., Reprod. Nutr. Dev. 2005, 45, 363-376. Brem, G., M. Müller, Large transgenic animals, in Animals with novel genes, N. Maclean, Editor. 1994, Cambridge University Press: Cambridge, UK. p. 179-244. Rijkers, T., A. Peetz, U. Rüther, Transgenic Res. 1994, 3, 203-215. Zinovieva, N., C. Lassnig, D. Schams, U. Besenfelder, E. Wolf, S. Müller, L. Frenyo, J. Seregi, M. Müller, G. Brem, Transgenic Res. 1998, 7, 437-447. Aigner, B., U. Besenfelder, J. Seregi, L.V. Frenyo, T. Sahintoth, G. Brem, Transgenic Res. 1996, 5, 405-411. Giraldo, P., L. Montoliu, Transgenic Res. 2001, 10, 83-103. Brem, G., U. Besenfelder, B. Aigner, M. Müller, I. Liebl, G. Schütz, L. Montoliu, Mol. Reprod. Dev. 1996, 44, 56-62. West, A.G., M. Gaszner, G. Felsenfeld, Genes Dev. 2002, 16, 271-288. Wall, R.J., Theriogenology 1996, 45, 57-68. Besenfelder, U., G. Brem, Theriogenology 1998, 50, 739-745. Besenfelder, U., J. Mödl, M. Müller, G. Brem, Theriogenology 1997, 47, 1051-1060. Besenfelder, U., N. Zinovieva, E. Dietrich, B. Sohnrey, W. Holtz, G. Brem, Vet. Rec. 1994, 135. Besenfelder, U., G. Brem, J. Reprod. Fert. 1993, 99, 53-56. Wetscher, F., V. Havlicek, T. Huber, M. Gilles, D. Tesfaye, J. Griese, K. Wimmers, K. Schellander, M. Muller, G. Brem, U. Besenfelder, Theriogenology 2005, 64, 30-40. Havlicek, V., F. Wetscher, T. Huber, G. Brem, M. Mueller, U. Besenfelder, J. Vet. Med. A Physiol. Pathol. Clin. Med. 2005, 52, 94-98.

1 Transgenic Modification of Production Traits in Farm Animals 32 Jaenisch, R., Proc. Natl. Acad. Sci. USA 1976, 73, 1260-1264. 33 Temin, H.M., Genome 1989, 31, 17-22. 34 Pfeifer, A., I.M. Verma, Annu. Rev. Genomics Hum. Genet. 2001, 2, 177-211. 35 Chan, A.W., E.J. Homan, L.U. Ballou, J.C. Burns, R.D. Bremel, Proc. Natl. Acad. Sci. USA 1998, 95, 14028-14033. 36 Cabot, R.A., B. Kuhholzer, A.W. Chan, L. Lai, K.W. Park, K.Y. Chong, G. Schatten, C.N. Murphy, L.R. Abeydeera, B.N. Day, R.S. Prather, Anim. Biotechnol. 2001, 12, 205-214. 37 Pannell, D., J. Ellis, Rev. Med. Virol. 2001, 11, 205-217. 38 Whitelaw, C.B., Trends Biotechnol. 2004, 22, 157-159; discussion 159-160. 39 Pfeifer, A., Transgenic Res. 2004, 13, 513-522. 40 Lois, C., E.J. Hong, S. Pease, E.J. Brown, D. Baltimore, Science 2002, 295, 868-872. 41 Hofmann, A., V. Zakhartchenko, M. Weppert, H. Sebald, H. Wenigerkind, G. Brem, E. Wolf, A. Pfeifer, Biol. Reprod. 2004, 71, 405-409. 42 Hofmann, A., B. Kessler, S. Ewerling, A. Kabermann, G. Brem, E. Wolf, A. Pfeifer, Mol. Ther. 2006, 13, 59-66. 43 Capecchi, M.R., Nat. Genet. 2000, 26, 159-161. 44 Familari, M., L. Selwood, Mol. Reprod. Dev. 2006, 73, 123-131. 45 Gjorret, J.O., P. Maddox-Hyttel, Reprod. Fertil. Dev. 2005, 17, 113-124. 46 Willadsen, S.M., Nature 1986, 320, 63-65. 47 Wilmut, I., A.E. Schnieke, J. McWhir, A.J. Kind, K.H.S. Campbell, Nature 1997, 385, 810-813. 48 Campbell, K.H.S., J. McWhir, W.A. Ritchie, I. Wilmut, Nature 1996, 380, 64-66. 49 Wells, D.N., P.M. Misica, H.R. Tervit, Biol. Reprod. 1999, 60, 996-1005. 50 Zakhartchenko, V., V. Alberio, M. Stojkovic, K. Prelle, W. Schernthaner, P. Stojkovic, H. Wenigerkind, R. Wanke, M. Düchler, R. Steinborn, M. Müller, G. Brem, E. Wolf, Mol. Reprod. Dev. 1999, 54, 264-272. 51 Kato, Y., T. Tani, Y. Sotomaru, K. Kurokawa, J. Kato, H. Doguchi, H. Yasue, Y. Tsunoda, Science 1998, 282, 2095-2098. 52 Baguisi, A., E. Behboodi, D.T. Melican, J.S. Pollock, M.M. Destrempes, C. Cam-

64 65

muso, J.L. Williams, S.D. Nims, C.A. Porter, P. Midura, M.J. Palacios, S.L. Ayres, R.S. Denniston, M.L. Hayes, C.A. Ziomek, H.M. Meade, R.A. Godke, W.G. Gavin, E.W. Overstrom, Y. Echelard, Nat. Biotechnol. 1999, 17, 456-461. Betthauser, J., E. Forsberg, M. Augenstein, L. Childs, K. Eilertsen, J. Enos, T. Forsythe, P. Golueke, G. Jurgella, R. Koppang, T. Lesmeister, K. Mallon, G. Mell, P. Misica, M. Pace, M. Pfister-Genskow, N. Strelchenko, G. Voelker, S. Watt, S. Thompson, M. Bishop, Nat. Biotechnol. 2000, 18, 1055-1059. Onishi, A., M. Iwamoto, T. Akita, S. Mikawa, K. Takeda, T. Awata, H. Hanada, A.C. Perry, Science 2000, 289, 1188-1190. Polejaeva, I.A., S.H. Chen, T.D. Vaught, R.L. Page, J. Mullins, S. Ball, Y. Dai, J. Boone, S. Walker, D.L. Ayares, A. Colman, K.H. Campbell, Nature 2000, 407, 86-90. Chesné, P., P.G. Adenot, C. Viglietta, M. Baratte, L. Boulanger, J.-P. Renard, Nat. Biotechnol. 2002, 20, 366-369. Woods, G.L., K.L. White, D.K. Vanderwall, G.P. Li, K.I. Aston, T.D. Bunch, L.N. Meerdo, B.J. Pate, Science 2003, 301, 1063. Galli, C., I. Lagutina, G. Crotti, S. Colleoni, P. Turini, N. Ponderato, R. Duchi, G. Lazzari, Nature 2003, 424, 635. Shin, T., D. Kraemer, J. Pryor, L. Liu, J. Rugila, L. Howe, S. Buck, K. Murphy, L. Lyons, M. Westhusin, Nature 2002, 415, 859. Lee, B.C., M.K. Kim, G. Jang, H.J. Oh, F. Yuda, H.J. Kim, M.H. Shamim, J.J. Kim, S.K. Kang, G. Schatten, W.S. Hwang, Nature 2005, 436, 641. Campbell, K.H., R. Alberio, I. Choi, P. Fisher, R.D. Kelly, J.H. Lee, W. Maalouf, Reprod. Domest. Anim. 2005, 40, 256-268. Cibelli, J.B., S.L. Stice, P.J. Golueke, J.J. Kane, J. Jerry, C. Blackwell, F.A. Ponce de Leon, J.M. Robl, Science 1998, 280, 1256-1258. Schnieke, A.E., A.J. Kind, W.A. Ritchie, K. Myco*ck, A.R. Scott, M. Ritchie, I. Wilmut, A. Colman, K.H.S. Campbell, Science 1997, 278, 2130-2133. Wells, K., Nat. Biotechnol. 2001, 19, 529-530. Piedrahita, J.A., Theriogenology 2000, 53, 105-116.

References 66 Dai, Y., T.D. Vaught, J. Boone, S.H. Chen, C.J. Phelps, S. Ball, J.A. Monahan, P.M. Jobst, K.J. McCreath, A.E. Lamborn, J.L. Cowell-Lucero, K.D. Wells, A. Colman, I.A. Polejaeva, D.L. Ayares, Nat. Biotechnol. 2002, 20, 251-255. 67 Denning, C., S. Burl, A. Ainslie, J. Bracken, A. Dinnyes, J. Fletcher, T. King, M. Ritchie, W.A. Ritchie, M. Rollo, P. de Sousa, A. Travers, I. Wilmut, A.J. Clark, Nat. Biotechnol. 2001, 19, 559-562. 68 Lai, L., D. Kolber-Simonds, K.W. Park, H.T. Cheong, J.L. Greenstein, G.S. Im, M. Samuel, A. Bonk, A. Rieke, B.N. Day, C.N. Murphy, D.B. Carter, R.J. Hawley, R.S. Prather, Science 2002, 295, 10891092. 69 McCreath, K.J., J. Howcroft, K.H.S. Campbell, A. Colman, A.E. Schnieke, A.J. Kind, Nature 2000, 405, 1066-1069. 70 Kuroiwa, Y., P. Kasinathan, H. Matsush*ta, J. Sathiyaselan, E.J. Sullivan, M. Kakitani, K. Tomizuka, I. Ishida, J.M. Robl, Nat. Genet. 2004, 36, 775-780. 71 Cibelli, J.B., K.H. Campbell, G.E. Seidel, M.D. West, R.P. Lanza, Nat. Biotechnol. 2002, 20, 13-14. 72 Renard, J.P., Q. Zhou, D. LeBourhis, P. Chavatte-Palmer, I. Hue, Y. Heyman, X. Vignon, Theriogenology 2002, 57, 203-222. 73 Lanza, R.P., J.B. Cibelli, D. Faber, R.W. Sweeney, B. Henderson, W. Nevala, M.D. West, P.J. Wettstein, Science 2001, 294, 1893-1894. 74 Wilmut, I., Nat. Med. 2002, 8, 215-216. 75 Perry, M.M., H.M. Sang, Transgenic Res. 1993, 2, 125-133. 76 Love, J., C. Gribbin, C. Mather, H. Sang, Biotechnology 1994, 12, 60-63. 77 Salter, D.W., E.J. Smith, S.H. Hughes, S.E. Wright, A.M. Fadly, R.L. Witter, L.B. Crittenden, Poult. Sci. 1986, 65, 14451458. 78 Iba, H., Dev. Growth Differ. 2000, 42, 213-218. 79 Harvey, A.J., G. Speksnijder, L.R. Baugh, J.A. Morris, R. Ivarie, Nat. Biotechnol. 2002, 19, 396-399. 80 Ivarie, R., Trends Biotechnol. 2003, 21, 14-19. 81 Lillico, S.G., M.J. McGrew, A. Sherman, H.M. Sang, Drug Discovery Today 2005, 10, 191-196. 82 Stern, C.D., Dev. Cell 2005, 8, 9-17.

83 Zbikowska, H.M., Transgenic Res. 2003, 12, 379-389. 84 Rocha, A., S. Ruiz, A. Estepa, J.M. Coll, Mar. Biotechnol. (NY) 2004, 6, 118-127. 85 Dorer, D.R., Transgenic Res. 1997, 6, 3-10. 86 Garrick, D., S. Fiering, D.I.K. Martin, E. Whitelaw, Nat. Genet. 1998, 18, 56-59. 87 Saffery, R., K.H. Choo, J. Gene Med. 2002, 4, 5-13. 88 Vos, J.M., Curr. Opin. Mol. Ther. 1999, 1, 204-215. 89 Robl, J.M., P. Kasinathan, E.J. Sullivan, Y. Kuroiwa, K. Tomizuka, I. Ishida, Theriogenology 2003, 59, 107-113. 90 Kuroiwa, Y., P. Kasinathan, Y.J. Choi, R. Naeem, K. Tomizuka, E.J. Sullivan, J.G. Knott, A. Duteau, R.A. Goldsby, B.A. Osborne, I. Ishida, J.M. Robl, Nature Biotechnol. 2002, 20, 889-894. 91 Hohn, B., A.A. Levy, H. Puchta, Curr. Opin. Biotechnol. 2001, 12, 139-143. 92 Baer, A., J. Bode, Curr. Opin. Biotechnol. 2001, 12, 473-480. 93 Gorman, C., C. Bullock, Curr. Opin. Biotechnol. 2000, 11, 455-460. 94 Coates, C.J., J.M. Kaminski, J.B. Summers, D.J. Segal, A.D. Miller, A.F. Kolb, Trends Biotechnol. 2005, 23, 407-419. 95 Kolb, A.F., C.J. Coates, J.M. Kaminski, J.B. Summers, A.D. Miller, D.J. Segal, Trends Biotechnol. 2005, 23, 399-406. 96 Mittal, V., Nat. Rev. Genet. 2004, 5, 355-365. 97 Novina, C.D., P.A. Sharp, Nature 2004, 430, 161-164. 98 Shinagawa, T., S. Ishii, Genes Dev. 2003, 17, 1340-1345. 99 Maga, E.A., Trends Biotechnol. 2005, 23, 533-535. 100 Verrinder Gibbins, A.M., Anim. Biotechnol. 1998, 9, 173-179. 101 Verrinder Gibbins, A.M., Nat. Biotechnol. 1998, 16, 1013-1014. 102 Palmiter, R.D., R.L. Brinster, R.E. Hammer, M.E. Trumbauer, M.G. Rosenfeld, N.C. Birnberg, R.M. Evans, Nature 1982, 360, 611-615. 103 Solomon, M.B., V.G. Pursel, E.W. Paroczay, D.J. Bolt, J. Anim. Sci. 1994, 72, 1242-1246. 104 Pinkert, C.A., E.J. Galbreath, C.W. Yang, L.J. Striker, Transgenic Res. 1994, 3, 401-405.

1 Transgenic Modification of Production Traits in Farm Animals 105 Ebert, K.M., T.E. Smith, F.C. Buonomo, E.W. Overstrom, M.J. Low, Anim. Biotechnol. 1990, 1, 145-159. 106 Niemann, H., Proc. Natl. Acad. Sci. U S A 2004, 101, 7211-7212. 107 Nottle, M.B., H. Nagashima, P.J. Verma, Z.T. Du, C.G. Grupen, S.M. McIlfatrick, R.J. Ashman, M.P. Harding, C. Giannakis, P.L. Wigley, I.G. Lyons, D.T. Harrison, B.G. Luxford, R.G. Campbell, R.J. Crawford, A.J. Robins, Production and analysis of transgenic pigs containing a metallothionein procine growth hormone gene construct, in Transgenic animals in agriculture, J.D. Murray, et al., Editors. 1999, CAB International: Wallingford UK. p. 145-156. 108 Pursel, V.G., A.D. Mitchell, G. Bee, T.H. Elsasser, J.P. McMurtry, R.J. Wall, M.E. Coleman, R.J. Schwartz, Anim. Biotechnol. 2004, 15, 33-45. 109 Bowen, R.A., M.L. Reed, A. Schnieke, G.E. Seidel, J.A. Stacey, W.K. Thomas, O. Kajikawa, Biol. Reprod. 1994, 50, 664-668. 110 Bellinge, R.H., D.A. Liberles, S.P. Iaschi, A. O’Brien P, G.K. Tay, Anim. Genet. 2005, 36, 1-6. 111 McPherron, A.C., A.M. Lawler, S.J. Lee, Nature 1997, 387, 83-90. 112 Yang, J., T. Ratovitski, J.P. Brady, M.B. Solomon, K.D. Wells, R.J. Wall, Mol. Reprod. Dev. 2001, 60, 351-361. 113 Pirottin, D., L. Grobet, A. Adamantidis, F. Farnir, C. Herens, H. Daa Schroder, M. Georges, Proc. Natl. Acad. Sci. U S A 2005, 102, 6413-6418. 114 Du, S.J., Z. Gong, G.L. Fletcher, M.A. Shears, M.J. King, D.R. Idler, C.L. Hew, Biotechnology 1992, 10, 176-181. 115 Devlin, R.H., T.Y. Yesaki, C.A. Biagi, E.M. Donaldson, P. Swanson, W.-K. Chan, Nature 1994, 371, 209-210. 116 Devlin, R.H., C.A. Biagi, T.Y. Yesaki, D.E. Smailus, J.C. Byatt, Nature 2001, 409, 781-782. 117 Devlin, R.H., L.F. Sundstrom, W.M. Muir, Trends Biotechnol. 2005. 118 Karatzas, C.N., Nat. Biotechnol. 2003, 21, 138-139. 119 Brophy, B., G. Smolenski, T. Wheeler, D. Wells, P. L’Huillier, G. Laible, Nat. Biotechnol. 2003, 21, 157-162. 120 Krimpenfort, P., A. Rademakers, W. Eyestone, A. van der Schans, S. van

den Broek, P. Kooiman, E. Kootwijk, G. Platenburg, F. Pieper, R. Strijker, H. DeBoer, Bio/Technology 1991, 9, 844-847. 121 Maga, E.A., G.B. Anderson, M.C. Huang, J.D. Murray, Transgenic Res. 1994, 3, 36-42. 122 van Berkel, P.H.C., M.M. Welling, M. Geerts, H.A. van Veen, B. Ravensbergen, M. Salaheddine, E.K.J. Pauwels, F. Pieper, J.H. Nuijens, P.H. Nibbering, Nat. Biotechnol. 2002, 20, 484-487. 123 Thomassen, E.A., H.A. van Veen, P.H. van Berkel, J.H. Nuijens, J.P. Abrahams, Transgenic Res. 2005, 14, 397-405. 124 Kumar, S., A.R. Clarke, M.L. Hooper, D.S. Horne, A.J.R. Law, J. Leaver, A. Springbett, E. Stevenson, J.P. Simons, Proc. Natl. Acad. Sci. USA 1994, 91, 61386142. 125 Stinnakre, M.G., J.L. Vilotte, S. Soulier, J.C. Mercier, Proc. Natl. Acad. Sci. USA 1994, 91, 6544-6548. 126 Stacey, A., A. Schnieke, M. Kerr, A. Scott, C. McKee, I. Cottingham, B. Binas, C. Wilde, A. Colman, Proc. Natl. Acad. Sci. USA 1995, 92, 2835-2839. 127 L’Huillier, P.J., S. Soulier, M.G. Stinnakre, L. Lepourry, S.R. Davis, J.C. Mercier, J.L. Vilotte, Proc. Natl. Acad. Sci. USA 1996, 93, 6698-6703. 128 Jost, B., J.L. Vilotte, I. Duluc, J.L. Rodeau, J.N. Freund, Nat. Biotechnol. 1999, 17, 160-164. 129 Brower, V., Nat. Biotechnol. 1998, 16, 728-731. 130 Reh, W.A., E.A. Maga, N.M. Collette, A. Moyer, J.S. Conrad-Brink, S.J. Taylor, E.J. DePeters, S. Oppenheim, J.D. Rowe, R.H. BonDurant, G.B. Anderson, J.D. Murray, J. Dairy Sci. 2004, 87, 3510-3514. 131 Wheeler, M.B., J. Anim. Sci. 2003, 81 Suppl 3, 32-37. 132 Muller, M., G. Brem, Rev. Sci. Tech. 1998, 17, 365-378. 133 Muller, M., G. Brem, J. Biotechnol. 1996, 44, 233-242. 134 Wall, R.J., A.M. Powell, M.J. Paape, D.E. Kerr, D.D. Bannerman, V.G. Pursel, K.D. Wells, N. Talbot, H.W. Hawk, Nat. Biotechnol. 2005, 23, 445-451. 135 Donovan, D.M., D.E. Kerr, R.J. Wall, Transgenic Res. 2005, 14, 563-567.

References 136 Clements, J.E., L.B. Hu, L. Lindstrom, A. Powell, C. Rexroad, M.C. Zink, AIDS Res. Hum. Retroviruses 1996, 12, 421-423. 137 Ernst, L.K., V.I. Zakcharchenko, N.M. Suraeva, T.I. Ponomareva, O.I. Miroshnichenko, M.I. Prokof’ev, T.I. Tikchonenko, Theriogenology 1990, 35, 1257-1271. 138 Muller, M., B. Brenig, E.L. Winnacker, G. Brem, Gene 1992, 121, 263-270. 139 Arnheiter, H., S. Skuntz, M. Noteborn, S. Chang, E. Meier, Cell 1990, 62, 51-61. 140 Weidle, U.H., H. Lenz, G. Brem, Gene 1991, 98, 185-191. 141 Lo, D., V. Pursel, P.J. Linto, E. Sandgren, R. Behringer, C. Rexroad, R.D. Palmiter, R.L. Brinster, Eur. J. Immunol. 1991, 21, 25-30. 142 Saif, L.J., M.B. Wheeler, Nat. Biotechnol. 1998, 16, 334-335. 143 Grosse-Hovest, L., S. Muller, R. Minoia, E. Wolf, V. Zakhartchenko, H. Wenigerkind, C. Lassnig, U. Besenfelder, M. Muller, S.D. Lytton, G. Jung, G. Brem, Proc. Natl. Acad. Sci. U S A 2004, 101, 6858-6863. 144 Zasloff, M., Nature 2002, 415, 389-395. 145 Yarus, S., J.M. Rosen, A.M. Cole, G. Diamond, Proc. Natl. Acad. Sci. USA 1996, 93, 14118-14121. 146 Reed, W.A., P.H. Elzer, F.M. Enright, J.M. Jaynes, J.D. Morrey, K.L. White, Transgenic Res. 1997, 6, 337-347. 147 Jia, X., A. Patrzykat, R.H. Devlin, P.A. Ackerman, G.K. Iwama, R.E. Hanco*ck, Appl. Environ. Microbiol. 2000, 66, 19281932. 148 Kerr, D.E., K. Plaut, A.J. Bramley, C.M. Williamson, A.J. Lax, K. Moore, K.D. Wells, R.J. Wall, Nat. Biotechnol. 2001, 19, 66-70. 149 Ono, E., K. Amagai, S. Taharaguchi, Y. Tomioka, S. Yoshino, Y. Watanabe, P. Cherel, L.M. Houdebine, M. Adam, M. Eloit, M. Inobe, T. Uede, Proc. Natl. Acad. Sci. U S A 2004, 101, 16150-16155. 150 Bueler, H., A. Aguzzi, A. Sailer, R.A. Greiner, P. Autenried, M. Aguet, C. Weissmann, Cell 1993, 73, 1339-1347. 151 Weissmann, C., Cell 2005, 122, 165-168. 152 Weissmann, C., A. Aguzzi, Annu. Rev. Med. 2005, 56, 321-344. 153 Hunter, C.V., L.S. Tiley, H.M. Sang, Trends Mol. Med. 2005, 11, 293-298.

154 Golovan, S.P., R.G. Meidinger, A. Ajakaiye, M. Cottrill, M.Z. Wiederkehr, D.J. Barney, C. Plante, J.W. Pollard, M.Z. Fan, M.A. Hayes, J. Laursen, J.P. Hjorth, R.R. Hacker, J.P. Phillips, C.W. Forsberg, Nat. Biotechnol. 2001, 19, 741-745. 155 Ward, K.A., Nat. Biotechnol. 2001, 19, 415-416. 156 Ward, K.A., Trends Biotechnol. 2000, 18, 99-102. 157 Saeki, K., K. Matsumoto, M. Kinosh*ta, I. Suzuki, Y. Tasaka, K. Kano, Y. Taguchi, K. Mikami, M. Hirabayashi, N. Kashiwazaki, Y. Hosoi, N. Murata, A. Iritani, Proc. Natl. Acad. Sci. U S A 2004, 101, 6361-6366. 158 Bawden, C.S., A.V. Sivaprasad, P.J. Verma, S.K. Walker, G.E. Rogers, Transgenic Res. 1995, 4, 87-104. 159 Bawden, C.S., B.C. Powell, S.K. Walker, G.E. Rogers, Transgenic Res. 1998, 7, 273-287. 160 Bawden, C.S., B.C. Powell, S.K. Walker, G.E. Rogers, Exp. Dermatol. 1999, 8, 342-343. 161 Damak, S., H.Y. Su, N.P. Jay, D.W. Bullock, Bio/Technology 1996, 14, 185-188. 162 Powell, B.C., S.K. Walker, C.S. Bawden, A.V. Sivaprasad, G.E. Rogers, Reprod. Fertil. Dev. 1994, 6, 615-623. 163 Palka-Santini, M., B. Schwarz-Herzke, M. Hosel, D. Renz, S. Auerochs, H. Brondke, W. Doerfler, Mol. Genet. Genomics 2003, 270, 201-215. 164 Heritage, J., Nat. Biotechnol. 2004, 22, 170-171. 165 Reichhardt, T., Nature 2000, 406, 10-12. 166 Muir, W.M., R.D. Howard, Proc. Natl. Acad. Sci. USA 1999, 96, 13853-13856. 167 Van Reenen, C.G., T.H.E. Meuwissen, H. Hopster, K. Oldenbroek, T.A.M. Kruip, H.J. Blokhuis, J. Anim. Sci. 2001, 79, 1763-1779. 168 Kaiser, M., Rev. Sci. Tech. 2005, 24, 75-87. 169 Davies, K.G., Trends Biotechnol. 2001, 19, 424-427. 170 Niemann, H., W. Kues, J.W. Carnwath, Rev. Sci. Tech. 2005, 24, 285-298. 171 Bulfield, G., Trends Biotechnol. 2000, 18, 10-13. 172 Fadiel, A., I. Anidi, K.D. Eichenbaum, Nucleic Acids Res. 2005, 33, 6308-6318. 173 Basrur, P.K., W.A. King, Rev. Sci. Tech. 2005, 24, 31-49.

2 Genetically Modified Plants Susanne Stirn and Horst Lörz

2.1 Methods for Establishing Genetically Modified Plants

As an introduction to genetically modified plants, we would first like to describe the methods of transformation currently used and the molecular requirements for stable introduction and expression of the genes of interest.

2.1.1 Transformation Methods

In general, two different means of transfer of foreign DNA into plant cells can be distinguished: 1. vector-mediated transformation (via Agrobacterium); and 2. direct gene-transfer methods.

2.1.1.1 Agrobacterium Transformation In the first method the natural ability of the bacterial phytopathogen Agrobacterium to transfer DNA into plant cells is exploited. Agrobacterium tumefaciens and Agrobacterium rhizogenes are soil microorganisms that induce crown gall tumors and hairy root disease, respectively, on a wide range of dicotyledonous plants and some monocotyledonous plants. For plant transformation, mainly A. tumefaciens is used; this bacterium contains a large tumor-inducing plasmid (Ti). During infection, a specific segment of the plasmid DNA, referred to as T-DNA (transferred DNA), is inserted into the plant genome. The T-DNA contains genes for phytohormones which are responsible for cell proliferation and for formation of the crown gall, and genes for the formation of special nutrients (opines) in the plant cell [1]. When Agrobacterium is used as a tool in genetic engineering these genes are deleted and replaced by the genes of interest. This is possible because only the 25 bp T-DNA border sequences on the right and left border are needed for DNA transfer. A wide

2.1 Methods for establishing genetically Modified Plants

variety of such “disarmed” (nontumor-inducing) vectors have been developed. Agrobacterium-mediated transformation is the most commonly used method for most dicotyledonous plants [2]. Advantages include the typical insertion of only one or a few copies of the transgene [3] and the transfer of relatively large segments of DNA with only minimal rearrangements [4].

2.1.1.2 Direct Gene Transfer For many years, Agrobacterium could not be used to transform monocotyledonous and other recalcitrant species, so direct gene-transfer methods were developed as an alternative. These include DNA uptake into protoplasts (protoplast transformation) and the shooting of DNA-coated particles into tissues (particle bombardment). Transformation of protoplasts In contrast with animal cells, plant cells have a solid cell wall which is the first barrier to overcome when foreign genes are to be transferred into them. One way of circumventing this barrier is to use plant cells of which the wall has been digested enzymatically, resulting in so-called protoplasts. DNA uptake into protoplasts can then be stimulated by the use of either poly(ethylene glycol) (PEG-transformation) or electric pulses (electroporation). When an appropriate protoplast-to-plant regeneration system is available, large numbers of transformed clones can be regenerated to afford fertile transgenic plants [5]. When a barrier to gene transfer has not been detected, virtually every protoplast system has proven transformable, although with substantial differences in efficiency [5]. Problems can, however, arise in the regeneration of fertile plants from protoplasts, because the regeneration is strongly species and genotype-dependant, and undesired somaclonal variation can occur, because of the relatively long tissue culture phase [6]. One advantage of protoplast transformation method is its great independence from other patented techniques. Particle bombardment The new method of using high-velocity microprojectiles to deliver DNA into plant tissue was developed by Sanford and colleagues in 1987 [7]. A particle gun is used to accelerate DNA-coated microprojectiles into cells, past the cell wall and the cell membrane. The microprojectile is small enough (0.5–5 μm) to enter the plant cell without causing too much damage yet is large enough to penetrate the cell wall and carry an appropriate amount of DNA on its surface [8]. The main advantage of particle bombardment is the absence of the biological incompatibilities observed when using biological vectors. Organelles such as chloroplasts have also been transformed by use of particle bombardment. Unfortunately, particle bombardment and other direct DNA uptake methods often result in complex insertion loci, which can cause gene silencing [2, 3].

2 Genetically Modified Plants

2.1.2 Tissue Requirements

The ability to cultivate plant tissue in vitro is a prerequisite in almost all current transformation procedures. Transformation requires competent (i.e. transformable) cultured cells that are embryogenic or organogenic. Plant cells suitable for regeneration are either cocultivated with Agrobacterium or bombarded. For Agrobacterium transformation, leaf disks or immature embryos are usually used for particle bombardment of monocotyledonous plant scutellar tissues.

2.1.3 Molecular Requirements

A typical plant gene consists of a promoter, a coding sequence, a transcription terminator, and a polyadenylation signal. The expression level of the gene is mainly determined by these components, but can also be affected by the surrounding sequences.

2.1.3.1 Promoter The promoter is the main determinant of the expression pattern in the transgenic plant. Constitutive promoters direct expression in all or almost all tissues, irrespective of developmental or environmental signals. The promoter directing the synthesis of the cauliflower mosaic virus 35S RNA is the most frequently used constitutive promoter; other constitutive promoters, for example the nopaline synthase (nos) promoter or the octopine synthase (ocs) promoter, are derived from agrobacterial T-DNA. Both are mainly used in dicotyledonous plants [9]. For monocotyledonous plants, promoters from the rice actin 1 gene (act1) [10] or the maize ubiquitin 1 gene (ubi1) [11] are usually used. To enhance expression levels, the first intron of the respective genes has been added to the expression cassettes [12]. In dicotyledonous plants, addition of introns seems to have fewer pronounced effects on the expression level. Nevertheless, insertion of an intron is always necessary when expression of the gene product in bacteria must be completely avoided (e.g. for genes conferring bacterial resistance – Section 2.3.1.3). When transgene expression should be directed at certain tissues or developmental stages, regulated promoters are required. Promoter elements responsible for expression in seeds, tubers, vegetative organs, and leaves have been isolated. Environmental effects can induce gene expression after wounding, heat or cold stress, or anaerobiosis. The use of natural inducible promoters has the disadvantage of causing pleiotropic effects, because endogenous genes will also be turned on [9]. Chemically induced promoters are favored for production of pharmaceuticals in transgenic plants, because production of the desired compound can be restricted to a certain time.

2.1 Methods for establishing genetically Modified Plants

2.1.3.2 Codon Usage Expression of the gene of interest can also be affected at the level of translation. Because codon usage differs between plants and bacteria, removal of rare codons, e.g., codons not frequently used in plant cells, from genes of bacterial origin can enhance expression substantially. This was first described for a modified Bacillus thuringiensis toxin gene, for which expression was enhanced up to one-hundredfold [13].

2.1.3.3 Selectable Marker and Reporter Genes In plant transformation systems, the efficacy of stable gene transfer is low; hence systems are required which enable the selection of the transformed cells. A selection system consists of a selective agent (which interferes with plant metabolism) and a selectable marker gene (which codes for a protein, enabling inactivation or evasion of the selective agent) [14]. The most commonly used selectable marker genes in transgenic plants code for antibiotic or herbicide resistance including the following. Antibiotic resistance genes • nptII gene: The neo or nptII gene, isolated from transposon Tn5 from Escherichia coli K12 codes for neomycin phosphotransferase (NPTII). This enzyme detoxifies a range of aminoglycoside antibiotics, for example neomycin, kanamycin, and geneticin [15]. These antibiotics are added to the culture medium after the transformation procedure. Only transformed cells or tissues will survive and will be regenerated to plants. • hpt gene: The hpt gene has been isolated from E. coli and codes for hygromycin phosphotransferase, which detoxifies the antibiotic hygromycin B. Most plant tissues are more sensitive to hygromycin B than to kanamycin or geneticin. In particular, cereals which are resistant to kanamycin and geneticin can be selected with hygromycin [14]. • bla gene: The blaTEM-1 gene codes for the TEM-1 β-lactamase, the most encountered ampicillin resistance marker in molecular biology. TEM-1 β-lactamase attacks narrow-spectrum cephalosporins and all the anti-Gram-negative-bacterium penicillins, except temocillin. Ampicillin resistance in transgenic plants is not usually used as selectable marker for plant transformation but is a remnant of the transformation method. With direct gene transfer methods it is used as a selectable marker during the cloning procedure before plant transformation. When present on the plasmid used for transformation, the ampicillin resistance gene is transferred and integrated together with the genes of interest, and remains under the control of its prokaryotic promoters [16]. • aadA gene: The aadA gene confers resistance to streptomycin and spectinomycin. The gene has been found in association with several transposons (Tn7, Tn21, …) and is ubiquitous among Gram-negative bacteria [15].

2 Genetically Modified Plants

Herbicide resistance genes • bar/pat gene: The bar gene from Streptomyces hygroscopicus and the pat gene from S. viridichromogenes code for phosphinotricin acetyltransferase (PAT) which confers resistance to the herbicide compound phosphinotricin [17]. It is an inhibitor of glutamine synthetase, a plant enzyme involved in ammonia assimilation. Besides phosphinotricin, the commercially available nonselective herbicides Basta and Bialaphos can be used as selective agent. Selection can be applied in the culture medium or by spraying of regenerated plantlets [14]. • EPSPS gene: The EPSPS gene codes for the enzyme 5-enolpyruvylshikimate5-phosphate synthase (EPSPS), which is involved in the skimatic acid pathway of aromatic amino acid biosynthesis. EPSPS is present in all plants, bacteria, and fungi, but not in animals. The nonselective herbicide glyphosate binds to and inactivates EPSPS. By transferring a glyphosate-resistant EPSPS gene from the soil bacterium Agrobacterium strain CP4 to plants, glyphosate-resistant crop plants have been obtained. Glyphosate is the active ingredient of the commercially available herbicide Roundup [18]. Reporter genes In contrast with selectable marker genes, reporter genes do not confer resistance to selective agents inhibitory to plant development. Reporter genes code for products which can be detected directly or catalyze reactions whose products are detectable [14]. • gusA gene: The gusA (uidA) gene encodes β-glucuronidase (GUS), which hydrolyzes a wide range of β-glucuronides [19]. Substrates for GUS are available for spectrometric, fluorimetric, and histochemical assays. The GUS reporter gene system enables easy quantification with high sensitivity [14]. One disadvantage of this system is its nonviability: examined cells and tissues cannot be regenerated into transgenic plants. This system is, therefore, mainly used to optimize a specific transformation procedure. • luc gene: The luciferase reporter gene assay use bioluminescence reactions with substrate–enzyme combinations which lead to detectable light emission. The luc gene originates from the firefly Photinus pyralis, and codes for a luciferase which decarboxylates beetle luciferin. In contrast with the GUS reporter system, the luciferase reporter gene is nonlethal to plant cells [20, 21]. Alternative marker and excision systems Because of discussion of the possible risk of transfer of antibiotic resistance genes from transgenic plants to clinically important microorganisms, alternative marker systems have been developed. Also, by use of excision systems the presence of antibiotic or herbicide resistance genes in the final product can be avoided [22]. • Alternative markers: Several alternative marker systems have recently been developed. For example, Chua and coworkers [23] successfully selected transgenic plants using an inducible Agrobacterium gene encoding for isopentenyltransferase (IPT). This enzyme catalyzes the first step in biosynthesis of cytokinins, a class of phytohormones. Only cells containing this gene are able to form shoots and differentiate into mature plants [23].

2.2 GM Plants Already on the Market (EU, USA, Canada, Japan)

As another alternative selection system, phosphomannose isomerase (PMI) was successfully used in transgenic sugar beet and maize. PMI catalyzes the interconversion of mannose-6-phosphate and fructose-6-phosphate. PMI is absent from most plants except leguminous plants and therefore only transgenic plants expressing the E. coli manA gene can survive on media containing mannose as a carbon source [24]. • Excision systems: Another approach is the use of recombination systems which enable the excision of marker genes in the successfully transformed plant. Four different site-specific recombination systems have been shown to function in plant cells. The best-characterized system in plants is the CRE/lox system of bacteriophage P1: the CRE recombinase enzyme specifically recognizes and catalyzes recombination between two lox sequences. Marker genes flanked by these lox sites can be precisely excised in the presence of the CRE recombinase. One disadvantage of the system was that the CRE protein had to be introduced in the transgenic plant via secondary transformation or sexual crossing with a CRE transformant [25]. When inducible developmental stage promoter or tissue-specific promoter are used, both components of the CRE/lox system can be transferred to one transformant. After selection of the transformants the promoter will be intentionally induced, resulting in excision of the marker gene [26, 27]. This system is also applicable to vegetatively propagated plants. A recent publication describes the efficient excision of selectable marker genes which are framed by attP-sites without the induction of a recombinase. The molecular basis of the reaction is still unknown, but presumably it is because of illegitimate recombination. Further experiments are necessary to reveal the underlying mechanism and to verify its general applicability [28, 29].

2.2 GM Plants Already on the Market (EU, USA, Canada, Japan)

In Europe, 23 genetically modified (crop) plants (GMPs) or products thereof have been approved for commercial use. These approvals covered different uses as applied for by the applicant. Approval usually covers the import and processing of genetically modified plants. Three genetically modified maize lines (Bt 176, Mon 810, T25) have also been approved for cultivation (Table 2.1). Nevertheless, few commercial plantings have been conducted in Europe (mainly Spain), and in Germany GMPs are grown only on an experimental scale. Worldwide, GMPs were grown on 81 million hectares in 2004, according to ISAAA, an increase of 20% in comparison with 2003. The rise in area is mainly because of increased planting of insect-resistant maize and cotton (+25%). Since 1996 the global area of transgenic crops has increased more than forty-sevenfold, with an increasing proportion grown by developing countries. The main producers of GMPs are the USA (47.6 million hectares), Argentina (16.2 million hectares), Canada (5.4 million hectares), Brazil (5 million hectares), China (3.7 million

2 Genetically Modified Plants Tab. 2.1 Genetically modified crop plants and products approved in the EU [30]. Plant (line)

Trait (gene)

Applicant

Approved use

Year

Soybean (GTS-40-3-2)

HR (CP4 EPSPS)

Monsanto

Import and processing

1996

Maize (Bt 176)

IR (cryIAb), HR (bar), ABR (bla)

Ciba–Geigy

Cultivation; import and processing

1997

Maize (Bt 11)

IR (cryIAb), HR (pat)

Northrup King

Import and processing; food use

1998; 2004

Maize (MON 810)

IR (cryIAb)

Monsanto

Cultivation; flour, semolina, starch and starch products, oil

1998; 1997

Maize (MON 809)

IR (cryIAb), HR (CP4 EPSPS, gox)

Pioneer

Food additives

1998

Maize (T 25)

HR (pat), ABR (partial bla)

AgrEvo

Cultivation; refined oil, starch 1998 and starch products, fermented or heat-treated products from maize flour

Maize (NK 603) HR (CP4 EPSPS)

Monsanto

Import and processing

2004

Maize (MON 863)

IR (cryIIIBb2), ABR (nptII)

Monsanto

Import and processing

2005

Maize (GA 21)

HR (maize EPSPS)

Monsanto

Processed food

2005

Maize (TC 1507)

IR (cryIFa2), HR (pat)

Mycogen/Pio- Food and feed use neer

Oil-seed rape (MS1 × RF1; MS1 × RF2)

MS/RF PGS (barnase/barstar), HR (bar), ABR (nptII)

Oil-seed rape (MS8 × RF3)

MS/RF (barnase/barstar), HR (bar)

PGS

Refined oil

1999

Oil-seed rape (HCN 92 = Topas 19/2)

HR (pat), ABR (nptII)

AgrEvo

Import and processing (feed); refined oil

1997

Oil-seed rape HR (pat) (HCN 28 = T45)

AgrEvo

Import and processing

2005

Oil-seed rape (GT 73)

HR (CP4 EPSPS, gox)

Monsanto

Refined oil

1997

Cotton (MON 1445/1698)

HR (CP4 EPSPS), ABR (nptII, aad)

Monsanto

Refined oil

2002

2005

Cultivation (breeding purposes); 1997 refined oil

2.2 GM Plants Already on the Market (EU, USA, Canada, Japan) Tab. 2.1 (continued) Plant (line)

Trait (gene)

Applicant

Approved use

Year

Cotton (MON 531/757/1076)

IR (cryIAc), ABR (nptII, aad)

Monsanto

Refined oil

2002

Cotton (MON 15985)

IR (cryIAc, cryIAb), ABR (nptII, aad), RP (uidA)

Monsanto

Refined oil

2002

HR = herbicide resistance (glyphosate resistance CP4 EPSPS gene, glyphosate resistance oxidoreductase gene (gox), glufosinate resistance pat or bar gene); ABR = antibiotic resistance (ampicillin resistance (bla), kanamycin resistance (nptII)), streptomycin resistance gene (aad); IR = insect resistance (Bacillus thuringiensis cryIA(b)); MS = male sterility (barnase); RF = restorer of fertility (barstar)

hectares), Paraguay (1.2 million hectares), India (0.5 million hectares), and South Africa (0.5 million hectares) [32, 33]. Genetically modified soybeans occupied 48.4 million hectares; GM maize was planted on 19.3 million hectares, transgenic cotton on 9.0 million hectares, and GM oil-seed rape on 4.3 million hectares. Fifty-six percent of global soybean production is now genetically modified and the percentage of GMPs in cotton, oil-seed rape, and maize is 28, 19, and 14%, respectively. Approximately 72% of GMPs contain a herbicide resistance gene, followed by 19% carrying insect resistance genes, and 9% carrying both herbicide and insectresistance genes (stacked genes). The two dominant crop–trait combinations in 2004 were herbicide-resistant soybean occupying 48.4 million hectares (or 60% of the global biotech area and grown in nine countries) and Bt maize (occupying 11.2 million hectares, equivalent to 14% of global biotech area and also grown in nine countries) [32]. 2.2.1 Herbicide Resistance in Soybean, Maize, Oil-seed rape, Sugar Beet, Wheat, Rice, and Cotton

As mentioned above, herbicide resistance is the leading trait in commercialized GMP, with 23 lines having been approved for cultivation and/or food and feed use worldwide (Table 2.2). 2.2.2 Insect Resistance in Maize, Potatoes, Tomatoes, and Cotton

Insect resistance is the trait found second most often in approved GMPs. Insectresistant lines, and lines which acquire an insect-resistance gene in combination with a herbicide resistance or virus resistance gene, are listed in Table 2.3.

2 Genetically Modified Plants Tab. 2.2 Herbicide-resistant crop plants and products worldwide [30, 31]. Plant (line)

Trait (gene)

Applicant

Country

Soybean (GTS-40-3-2)

HR (CP4 EPSPS)

Monsanto

Argentina, Australia, Brazil, Canada, China, Czech Republic, EU, Japan, Korea, Mexico, Philippines, Russia, Switzerland, South Africa, Taiwan, UK, Uruguay, USA

Soybean (A 2704-12, A 2704-21, A 5547-35)

HR (pat)

AgrEvo

Canada, Japan, USA

Soybean (A 5547-127)

HR (pat), ABR (partial bla)

AgrEvo

USA

Soybean (GU 262)

HR (pat), ABR (partial bla)

AgrEvo

USA

Soybean (W 62, W 98)

HR (bar), RP (gus)

AgrEvo

USA

Maize (GA 21)

HR (maize EPSPS)

Monsanto

Argentina, Australia, Canada, China, EU, Japan, Korea, Philippines, Taiwan, USA

Maize (NK 603)

HR (CP4 EPSPS)

Monsanto

Argentina, Australia, Canada, EU, Japan, Philippines, Taiwan, South Africa, USA

Maize (MON 832)

HR (CP4 EPSPS, gox), ABR (nptII)

Monsanto

Canada

Maize (B 16 = DLL 25)

HR (bar), ABR (bla)

DeKalb

Canada, Japan, Philippines, Taiwan, USA

Maize (T 14, T 25)

HR (pat), ABR (partial bla)

AgrEvo

Argentina, Australia, Canada, EU, Japan, Philippines, Taiwan, USA

Oil-seed rape (GT 73)

HR (CP4 EPSPS, gox)

Monsanto

Australia, Canada, China, EU, Japan, Philippines, USA

Oil-seed rape (GT 200)

HR (CP4 EPSPS, gox)

Monsanto

Canada, USA

Oil-seed rape (HCN 92 = Topas 19/2)

HR (pat), ABR (nptII)

AgrEvo

Canada, EU, Japan, USA

Oil-seed rape (HCN 10)

HR (pat)

AgrEvo

Canada, Japan, USA

Oil-seed rape (HCN 28 = T 45)

HR (pat)

AgrEvo

Australia, Canada, EU, Japan, USA

2.2 GM Plants Already on the Market (EU, USA, Canada, Japan) Tab. 2.2 (continued) Plant (line)

Trait (gene)

Applicant

Country

Oil-seed rape (Oxy 235)

HR (bxn)

Rhone Poulenc

Australia, Canada, Japan, USA

Brassica rapa (ZSR 500, 501, 502)

HR (CP4 EPSPS, gox)

Monsanto

Canada

Cotton (MON 1445/1698)

HR (CP4 EPSPS), ABR (nptII, aad)

Monsanto

Argentina, Australia, Canada, China, EU, Japan, Philippines, South Africa, USA

Cotton (BXN)

HR (bxn), ABR (nptII)

Calgene

Australia, Canada, Japan, USA

Cotton (LL Cotton 25)

HR (bar)

Bayer Crop Science

Canada, USA

Cotton (19-51A)

HR (als)

DuPont

USA

Cotton (MON 88913)

HR (CP4 EPSPS)

Monsanto

USA

Sugar beet (T120-7)

HR (pat), ABR (nptII)

AgrEvo

Canada, Japan, USA

Sugar beet (GTSB 77)

HR (CP4 EPSPS, gox)

Novartis

Australia, Philippines, USA

Sugar beet (H7-1)

HR (CP4 EPSPS)

Monsanto

Philippines, USA

Wheat (MON 71800)

HR (CP4 EPSPS)

Monsanto

USA

Rice (LLRICE 06, 62)

HR (bar)

AgrEvo

USA

Flax (FP967)

HR (als) ABR (nptII)

University of Canada, USA Saskatoon

HR = herbicide resistance (glyphosate resistance CP4/maize EPSPS gene, glyphosate resistance oxidoreductase gene (gox), glufosinate resistance pat or bar gene, romoxynil herbicide resistance nitrilase gene (bxn), sulfonylurea resistance als gene); ABR = antibiotic resistance (ampicillin resistance gene bla, kanamycin resistance gene nptII, streptomycin resistance gene (aad)); RP = reporter gene (gus)

2.2.3 Virus-resistance, Male Sterility, Delayed Fruit Ripening, and Fatty Acid Content of GMPs

GMPs with virus resistance (potato, squash, and papaya; Table 2.4), male sterility (oil-seed rape, maize, and chicory; Table 2.5), delayed fruit ripening (tomato; Table 2.6) and modified fatty acid content (soybean, oil-seed rape; Table 2.7) have also been approved in some countries.

2 Genetically Modified Plants Tab. 2.3 Insect-resistant crop plants and products worldwide [30, 31]. Plant (line)

Trait (gene)

Applicant

Country

Maize (MON 810)

IR (cryIAb)

Monsanto

Argentina, Australia, Canada, China, EU, Korea, Japan, Philippines, South Africa, Switzerland, Taiwan, USA

Maize (MON 802)

IR (cryIAb), HR (CP4 EPSPS, gox), ABR (nptII)

Monsanto

Canada, Japan, USA

Maize (MON 80100)

IR (cryIAb), HR (CP4 EPSPS, gox), ABR (nptII)

Monsanto

USA

Maize (MON 863)

IR (cryIIIBb2), ABR (nptII)

Monsanto

Australia, Canada, EU, Japan, Philippines, Taiwan, USA

Maize (MON 88017)

IR (cryIIIBb1), HR (CP4 EPSPS)

Monsanto

USA

Maize (MON 809)

IR (cryIA(b)), HR (CP4 EPSPS, gox)

Pioneer

Canada, Japan, USA

Maize (Bt 176)

IR (cryIAb), HR (bar), ABR (bla)

Ciba–Geigy

Argentina, Australia, Canada, EU, Japan, Philippines, Switzerland, Taiwan, USA

Maize (Bt 11)

IR (cryIAb), HR (pat)

Northrup King (Syngenta)

Argentina, Australia, Canada, China, EU, Korea, Japan, Philippines, Russia, Taiwan, South Africa, Switzerland, UK, Uruguay, USA

Maize (DBT 418)

IR (cryIAc, protease inhibitor II (pinII)); HR (bar), ABR (bla)

DeKalb

Argentina, Australia, Canada, Japan, Philippines, Taiwan, USA

Maize (TC1507)

IR (cryIFa2), HR (pat)

Mycogen/ Pioneer

Argentina, Canada, EU, Japan, Philippines, South Africa, Taiwan, USA

Maize (DAS-06275-8)

IR (cryIF), HR (bar)

Dow Agro Sciences

USA

Maize (DAS-59122-7)

IR (cry34Ab1, cry35AB1), Dow Agro HR (pat) Sciences

USA

Potato (Bt 6, Russet Burbank New Leaf)

IR (cryIIIA), ABR (nptII)

Canada, Japan, Philippines, USA

Monsanto

2.2 GM Plants Already on the Market (EU, USA, Canada, Japan) Tab. 2.3 (continued) Plant (line)

Trait (gene)

Applicant

Country

Potato (ATBT04-6 etc., 4 lines Atlantic and Superior New Leaf)

IR (cryIIIA), ABR (nptII)

Monsanto

Australia, Canada, Japan, Philippines, USA

Potato (SEMT 15-15, New Leaf Y)

IR (cryIIIA), VR (coat protein PVY) ABR (nptII, aad)

Monsanto

Australia, Canada, Philippines, USA

Potato (RBTM 21-350, Russet Burbank New Leaf Plus)

IR (cryIIIA), VR (replicase PLRV, helicase PLRV) ABR (nptII)

Monsanto

Australia, Canada, Japan, Philippines, USA

Cotton (MON 531, 757, 1076, Bollgard)

IR (cryIAc), ABR (nptII, aad)

Monsanto

Argentina, Australia, Brazil, Canada, China, India, Japan, Mexico, Philippines, South Africa, USA

Cotton (MON 15985, Bollgard II)

IR (cryIAc, cryIAb), ABR (nptII, aad), RP (uidA)

Monsanto

Australia, Canada, EU, Japan, Philippines, USA

Cotton (31807/31808)

IR (cryIAc), HR (bxn) ABR (nptII)

Calgene

Japan, USA

Cotton (3006-210-23)

IR (cryIAc), HR (pat)

Dow AgroSciences

Mexico, USA

Cotton (281-24-236)

IR (cryIFa2), HR (pat)

Dow AgroSciences

Mexico, USA

Tomato (5345)

IR (cryIAc), ABR (nptII, aad)

Monsanto

Canada, USA

IR = insect resistance (delta endotoxin genes of Bacillus thuringiensis (cryIAb, cryIAc, cryIIIA, cryIFa2; protease inhibitor II (pinII)); HR = herbicide resistance (glyphosate resistance CP4 EPSPS gene, glyphosate resistance oxidoreductase gene (gox), glufosinate resistance pat or bar gene, bromoxynil herbicide resistance nitrilase gene (bxn)); VR = virus resistance (potato virus Y (PVY) coat protein gene, replicase and helicase gene of potato leafroll virus (PLRV), respectively); ABR = antibiotic resistance (ampicillin resistance (bla), kanamycin resistance (nptII), streptomycin resistance (aad)); RP = reporter gene (beta-D-glucuronidase (gus))

2 Genetically Modified Plants Tab. 2.4 Virus-resistant crop plants and products worldwide [31]. Plant (line)

Trait (gene)

Applicant

Country

Potato (SEMT 15-15, New Leaf Y)

VR (coat protein PVY), IR (cryIIIA), ABR (nptII, aad)

Monsanto

Australia, Canada, Philippines, USA

Potato (RBTM 21-350, Russet Burbank New Leaf Plus)

VR (replicase PLRV, helicase PLRV), IR (cryIIIA), ABR (nptII)

Monsanto

Australia, Canada, Japan, Philippines, USA

Squash (CZW-3)

VR (coat protein CMV, coat protein ZYMV, coat protein WMV 2), ABR (nptII)

Asgrow

Canada, USA

Squash (ZW20)

VR (coat protein ZYMV, Upjohn coat protein WMV 2)

Canada, USA

Papaya (55-1/63-1)

VR (coat protein PRSV), Cornell University RP (gus), ABR (nptII)

Canada, USA

VR = virus resistance (coat protein genes of potato virus Y (PVY), cucumber mosaic virus (CMV), zucchini yellows mosaic virus (ZYMV) and watermelon mosaic virus (WMV) 2, respectively; replicase and helicase genes of potato leafroll virus (PLRV)); IR = insect resistance (delta endotoxin gene of Bacillus thuringiensis (cryIIIA)); ABR = antibiotic resistance (kanamycin resistance (nptII), streptomycin resistance (aad)); RP = reporter gene (gus)

Tab. 2.5 Male sterility in crop plants worldwide [30, 31]. Plant (line)

Trait (gene)

Applicant

Country

Oil-seed rape (MS1, RF1 (PGS1))

MS (barnase), FR (barstar), HR (bar), ABR (nptII)

PGS

Australia, Canada, EU, Japan, USA

Oil-seed rape (MS1, RF2 (PGS2))

MS (barnase), FR (barstar), HR (bar), ABR (nptII)

PGS

Australia, Canada, EU, Japan, USA

Oil-seed rape (MS8 × RF3)

MS (barnase), FR (barstar), HR (bar)

PGS

Australia, Canada, Japan, USA

Oil-seed rape (PHY14, PHY35)

MS (barnase), FR (barstar), HR (bar)

PGS

Japan

2.2 GM Plants Already on the Market (EU, USA, Canada, Japan) Tab. 2.5 (continued) Plant (line)

Trait (gene)

Applicant

Country

Oil-seed rape (PHY36)

MS (barnase), HR (bar), ABR (bla)

PGS

Canada, USA

Maize (MS3)

MS (barnase), HR (bar), ABR (bla)

PGS

Japan

Maize (MS6)

MS (barnase), HR (bar), ABR (bla)

USA

Maize (676, 678, 680)

MS (dam), HR (pat)

Pioneer

USA

Chicory (RM3-3, RM3-4, RM3-6)

MS (barnase), HR (bar), ABR (nptII)

Bejo Zaden

EU, USA

MS = male sterility (barnase from Bacillus amyloliquefaciens, dam (DNA adenine methylase from E. coli); FR = fertility restoration (barstar from Bacillus amyloliquefaciens); HR = herbicide resistance (glufosinate resistance bar gene); ABR = antibiotic resistance (ampicillin resistance (bla), kanamycin resistance (nptII))

Tab. 2.6 Delayed fruit ripening in tomatoes and tomato products worldwide [31]. Plant (line)

Trait (gene)

Applicant

Country

Tomato (FLAVR SAVR)

See Also

My perfect Sims 5 | EA Forums - 1921603

DR (PG, anti-sense) ABR (nptII)

Calgene

Canada, Japan, Mexico, USA

Tomato (B, Da, F)

DR (PG, sense or antisense) ABR (nptII)

Zeneca

Canada, USA

Tomato (8338)

DR (ACCd) ABR (nptII)

Monsanto

USA

Tomato (35 1 N)

DR (sam-K) ABR (nptII)

Agritope

USA

Tomato (1345-4)

DR (ACC, sense) ABR (nptII)

DNA Plant Canada, USA Technology Corporation

DR = delayed ripening (polygalacturonase gene in sense or anti-sense direction (PG); 1-aminocyclopropane-1-carboxylic acid deaminase gene (ACCd); S-adenosylmethionine hydrolase gene with Kozak consensus sequence (sam-K); aminocyclopropane cyclase synthase gene in sense orientation (ACC)); ABR = antibiotic resistance (kanamycin resistance (nptII))

2 Genetically Modified Plants Tab. 2.7 Modified fatty acid content in crop plants and products worldwide [31]. Plant (line)

Trait (gene)

Applicant

Country

Soybean (G94-1, G94-19, G168, high-oleic soybean)

MFA (GmFad2-1), ABR (bla), RG (gus)

DuPont

Australia, Canada, Japan, USA

Oil-seed rape (23-18-17, 23-198, high-laurate canola)

MFA (BayTE), ABR (nptII)

Calgene

Canada, USA

MFA = modified fatty acid content (delta 12 desaturase gene (GmFad2-1); thioesterase gene from Umbellaria californica (Bay TE); ABR = antibiotic resistance (ampicillin resistance (bla), kanamycin resistance (nptII)); RP = reporter gene (gus)

2.3 GM Plants “In the Pipeline” 2.3.1 Input Traits

The following sections contain selected examples of studies being conducted in the genetic engineering of crop plants. First, attempts to reduce the production costs of crop plants are summarized. These are studies of crop plants with genetically engineered resistance against insects, diseases, and abiotic stresses, and with improved agronomic properties.

2.3.1.1 Insect Resistance The best-characterized insecticidal proteins are the delta-endotoxins of Bacillus thurigiensis (B. t.-toxins), which have been used as biopesticides in agriculture (and organic farming), forestry, and as a mosquito vector control for many years. B. t. insecticidal activity is highly specific in that the endotoxins are nontoxic to nontarget insects, birds, and mammals. Besides the commercially available B. t.-maize, potato, cotton, and tomato lines (Table 2.3), insect-resistant rice (cryIAb and cryIAc) [34, 35], soybeans (cryIAc) [36], oil-seed rape (cryIAc) [37] and eggplants (cryIIIB) [38] have been developed. Field trials have also been performed in the USA with insect-resistant sunflower, lettuce, grapefruit, sugarcane, apple, walnut, grape, and peanut [39]. To control corn rootworm infections, Mycogen c/o Dow AgroSciences and Pioneer Hi-Bred have developed transgenic maize which contains two novel proteins from Bacillus thuringiensis strain PS149B1. These proteins belong to another class of insecticidal proteins with no hom*ology to the delta-endotoxins (Bt PS149B1 toxins) [40, 41].

2.3 GM Plants “In the Pipeline”

Another approach used to obtain insect-resistant plants is to use plant defense proteins such as proteinase inhibitors [42, 43], lectins [44] or alpha-amylase inhibitor [45]. Lectins are thought to confer resistance toward sap-sucking insects (e.g. the rice brown planthopper) which act as vector for virus transmission [44]. Since the publication of Ewen and Pusztai, the possible toxic effects of the snowdrop lectin on mammals have been widely discussed [45, 46]. Morton and colleagues transferred the alpha-amylase inhibitor 1 gene from beans to peas and conducted field trials with the insect-resistant pea plants; they reported high insect mortality in transgenic plants [47]. One advantage of using alpha-amylase inhibitor genes is the long history of human consumption of beans and the fact that bean alpha-amylase has no effect on starch digestion in humans [47]. In an attempt to confer broad-spectrum resistance to storage pests, maize was transformed with the chicken avidin gene [48]. Because the mode of action of avidin is to cause a deficiency of the vitamin biotin in insects, thorough safety testing for human consumption must be conducted before commercial use of biotin maize.

2.3.1.2 Virus, Fungal, Bacterial, and Nematode Resistance Virus resistance One strategy used to obtain virus-resistant plants is to transfer genes from the pathogen itself into the plant (pathogen-derived resistance). The most widely used approach is to express the virus coat protein in transgenic plants. In theory, the expression of viral genes disrupts viral infection or symptom development. All but one of the commercially available virus-resistant plants contain viral coat proteins (Table 2.4), and this technique has been extended to other plants, for example rice [49], plum tree [50], tomato [51], pea [52], and peanut [53]. Field trials have also been performed, in the USA, with coat protein-mediated virusresistant wheat, soybean, sugarcane, sugar beet, cucumber, sweet potato, grapefruit, pineapple, and papaya [39]. Another form of pathogen-derived resistance is the use of viral replicase genes (or RNA-dependent RNA polymerase genes), which presumably act by post-transcriptional gene silencing. This technique has been used to confer resistance to potato leafroll virus in potato (Table 2.4), to barley yellow dwarf virus in oats, cucumber mosaic virus in tomato, rice tungro spherical virus in rice, and wheat streak mosaic virus in wheat [54–57]. Because different degrees of virus resistance have been obtained with coat protein-mediated resistance, attempts have been made to ameliorate resistance against cucumber mosaic virus via satellite RNA, especially in tomato [58, 59]. This approach has caused controversy, however, because a single-point mutation in the satellite RNA can transform it into a harmful necrogenic form [60]. To protect plants against more than one virus, ribosome-inactivating proteins (RIPs) have been expressed in transgenic plants. RIPs are strong inhibitors of protein synthesis and, depending on the plant species from which they originate, they have different levels of toxicity against different hosts. Poke weed antiviral protein

2 Genetically Modified Plants

(PAP) confers resistance to PVX and PVY in transgenic potatoes and PAPII confers resistance to TMV, PVX, and fungal infections in tobacco [61, 62]. On a more experimental scale are approaches to achieve virus resistance by using antibodies against the virus coat protein. Such antibodies can neutralize virus infection, presumably by interacting with newly synthesized coat protein and disrupting viral particle formation [63, 64]. Similar to RIPs, broad-spectrum antibodies might be used to protect plants against a wider range of viruses, as has been demonstrated for poty viruses [64]. Fungal resistance Fungal resistance can be conferred by activation of specific self-defense mechanisms in the plant. One of the mechanisms is the so-called hypersensitive response (HR), which enables plants to enclose the pathogen in the infected area by formation of necrotic lesions. HR induces many defense-related signal molecules such as salicylic acid, ethylene, and phytoalexin. HR is also characterized by an accumulation of pathogenesis-related (PR) proteins that include fungal cell wall-degrading enzymes, antimicrobial peptides, thionins, lipid-transfer proteins, and proteinase inhibitors [65]. In rice, the introduction of chitinase and thaumatin-like protein led to increased resistance to sheath blight (Rhizoctonia solani) [66–68]. Enhanced resistance to the rice blast fungus Magnaporthe grisea was observed on constitutive expression of chitinase and defense-related protein genes in transgenic rice [69, 70]. Pathogenesis-related proteins from plants have been used to confer fungal resistance in alfalfa [71], cucumber [72], oil-seed rape [73], tomatoes [74], wheat [75–77], grape vine [78], and oranges [79]. Other antifungal genes of plant origin are genes for RIPs [80], genes for phytoalexins [81–84], and anthocyanin genes [85]. An example of an antifungal gene from nonplant sources which has been transferred to plants is the human lysozyme gene [86]. In the USA field trials have been performed with fungus-resistant wheat, barley, maize, soybean, potato. rice, bananas, and cotton using different antifungal proteins [39]. Individual PR-proteins, however, have a narrow spectrum of antifungal activity, and must function collectively to provide modest but long-term resistance. Research is, therefore, currently focusing on genes from mycoparasitic fungi as a means of improving resistance to fungal pathogens. An endochitinase of the mycoparasitic fungus Trichoderma harzianum has been transferred to tobacco and potato, and has been reported to confer a high level and broad spectrum of resistance [87]. When transferred to apple, however, the endochitinase of Trichoderma harzianum increased resistance to apple scab but also reduced plant growth [88]. A similar approach has been taken by transferring to wheat an antifungal protein from a virus that persistently infects Ustilago maydis. Transgenic wheat plants had increased resistance against stinking mut (Tilletia tritici) [89]. For a comprehensive survey of the different approaches used to achieve fungal resistance in transgenic plants see Tables 1 and 2 in Ref. [90].

2.3 GM Plants “In the Pipeline”

Bacterial resistance Resistance to bacterial infections is not yet as well developed as virus and fungal resistance, partly because bacterial diseases are a major problem only in crop plants such as potato, tomato, rice, and some fruit trees. The most efficient form of protection is genetic resistance, which is based on single dominant or semidominant genes. These R genes usually confer race-specific resistance, and their effectiveness is based on their interaction with complementary pathogen avirulence (AV) genes in the pathogen, the so called gene-forgene interaction [91]. Resistance to bacterial blight caused by Xanthom*onas oryzae pv. oryzae was achieved by transferring the resistance gene Xa21 from a wild rice species to the elite indica rice variety “IR72” [92]. In the same way, the resistance gene Bs2 from pepper was transferred to tomato, which then had resistance to bacterial spot disease [93]. The tomato disease resistance gene Pto gives race-specific resistance to Pseudomonas syringae pv. tomato carrying the avrPto gene. By overexpressing Pto race-nonspecific resistance was observed in transgenic tomatoes [94]. Resistance based on single dominant gene expression always bears the danger of early evolution of counter-resistance in the pathogen as a result of the emergence of strains that no longer express the specific avirulence gene product [93]. Therefore, new resistance genes are being investigated for use in pyramiding strategies (combination of resistance genes against the same pathogen, but with different targets). One example is the AP1 gene from sweet pepper which delays the hypersensitive response when expressed in transgenic rice plants and which can be used in combination with Xa21 or other resistance genes [95]. Similarly to fungal resistance, overexpression of PR proteins or transfer of PR protein genes from other sources has led to enhanced resistance against bacterial infections – expression of barley lipid transfer protein LTP2 resulted in enhanced tolerance to bacterial pathogens in transgenic tobacco plants [96]. In several plant species, bifunctional enzymes with lysozyme activity have been detected which are thought to be involved in defense against bacteria. After transfer of the bacteriophage T4 lysozyme gene, transgenic potatoes had reduced susceptibility toward Erwinia carotovora atroseptica infections [97]. Transfer of the human lysozyme gene to tobacco led to enhanced resistance against both fungal and bacterial diseases [98]. Plant defense responses also involve production of active oxygen species, for example hydrogen peroxide (H2O2). This mechanism was exploited by transferring a fungal gene encoding H2O2-generating glucose oxidase to potato plants. The transgenic potato tubers had strong resistance to Erwinia carotovora subsp. carotovora infections, which cause bacterial soft rot disease, and enhanced resistance to potato late blight, caused by Phytophthora infestans [99]. Insects produce antimicrobial peptides as a major defense response to pathogen attack. These include sarcotoxins, cecropins, and attacins. The last of these have been transferred to apples and pears which then had improved resistance to Erwinia amylovora, which causes fire blight [100, 101]. Sarcotoxins seem to confer greater anti-bacterial activity and a broader spectrum of resistance, as indicated by experiments with transgenic tobacco [65]. Similarly, the expression of synthetic

2 Genetically Modified Plants

antimicrobial peptide chimeras in transgenic tobacco led to broad-spectrum resistance against both bacterial and fungal pathogens [102]. Bacteria-resistant grapes, transformed with the antibiotic protein mangainin from toads, are being field tested in the USA [39]. Nematode resistance In the USA, field tests are being conducted with nematoderesistant soybeans, carrots, tomatoes, potatoes, and pineapples [39]. In carrot, tomato, potato, and pineapple cysteine proteinase inhibitors from cowpea and rice have been expressed in the transgenic plants. Proteinase inhibitors are an important aspect of natural plant defense strategies. The cowpea trypsin inhibitor (CpTI), a serine proteinase inhibitor, and oryzacystatin (Oc-I), an inhibitor of cysteine proteinase, have been shown to be effective against proteinases of a cyst nematode. After site-directed mutagenesis of the latter, the modified cystatin had enhanced efficacy as a transgene against potato cyst nematode. In field trials no detrimental effect on plant growth was observed in transgenic potatoes [103]. When two partial nematode-resistant potato varieties were transformed with the cystatin, full resistance to potato cyst nematode Globodera was achieved [104]. Cysteine proteinase inhibitors are of particular interest because they are the only class of proteinase that is not expressed in the digestive system of mammals [105].

2.3.1.3 Tolerance Against Abiotic Stress The effects of weather, erosion, and depleted soils expose plants to a variety of stresses. Genetic engineering has been used to provide plants with additional stress response genes to counteract these environmental stresses. These genes can be grouped into two categories: 1. genes that respond directly against a particular stress; and 2. genes that regulate stress gene expression and signal transduction. Transfer or overexpression of both types of gene has been used in transgenic approaches to enhance tolerance against abiotic stresses. In the following section, salt, drought, and cold stress are considered together, because on a cellular basis all act as dehydration stress. Genes conferring dehydration-stress tolerance to transgenic plants Plants react to these stresses by displaying complex, quantitative traits that involve the function of many genes. Expression of these genes leads to the accumulation of low-molecular-weight components, for example osmolytes, synthesis of late-embryogenesisabundant (LEA) proteins, and activation of detoxifying enzymes. In transgenic approaches, genes for the enzymes responsible for production of these compounds have been transferred to nontolerant plants. Most of these studies have been performed in model plants such as Arabidopsis or tobacco, but some investigations have been extended to food crops such as rice. Bajaj and coworkers summarized results from these studies in a recent review [106]. After transfer of genes encoding enzymes for osmoprotectants such as glycinebetaine [107], proline [108] or putrescine [109], transgenic rice plants had

2.3 GM Plants “In the Pipeline”

increased tolerance to salt and drought stress. Constitutive overexpression of the oat arginine decarboxylase gene in rice led to severely affected developmental patterns [109]. When the arginine decarboxylase gene was under control of an ABAinducible promoter, an increase in biomass was observed for transgenic rice plants under salinity-stress conditions [110]. Transgenic rice plants expressing the arginine decarboxylase gene (adc) from Datura produced high levels of the polyamine putrescine under stress; this protected the plants from drought [111]. The expression of an LEA protein in transgenic rice plants led to increased tolerance to water deficit and salt stress in the plants [112]. As it is believed that abiotic stress primarily affects plants by causing oxidative damage; genes for detoxifying enzymes have been transferred to sensitive plants. McKersie et al. [113] showed that transgenic alfalfa overexpressing Mn superoxide dismutase, which reduces free radicals, was more tolerant of water deficit and freezing and had better winter survival rates. It is envisaged that use of stress-inducible promoters and the introduction of multiple genes will improve dehydration-stress tolerance [106]. Regulatory genes encoding transcription factors Another promising approach for conferring tolerance to dehydration stress is to transfer regulatory genes. Because the products of these genes regulate gene expression and signal transduction under stress conditions, their overexpression can activate the expression of many stress-tolerance genes simultaneously. Overexpression of the transcription factor DREB1A in transgenic Arabidopsis led to increased tolerance to drought, salt, and freezing stresses. The constitutive overexpression of DREB1A also resulted in severe growth retardation under normal growth conditions, however. In contrast, the stress-inducible expression of this gene had minimal effects on plant growth, and provided greater tolerance to stress conditions than genes driven by the 35S promoter [106, 114]. Drought-tolerant wheat lines transformed with DREB1A are currently being field tested in Mexico [115]. Lee and colleagues [116] cloned the functional hom*olog of the yeast Dbf2 kinase that enhances salt, drought, cold, and heat tolerance on overexpression in yeast and in transgenic plant cells. Use of this gene to engineer transgenic crops with enhanced stress tolerance has still to be demonstrated, however [116]. Additional genes that confer tolerance to salt stress The detrimental effects of salt on plants are a consequence both of a water deficit, resulting in osmotic stress, and of the effects of excess sodium ions on key biochemical processes. To tolerate high levels of salts, plants should be able to use ions for osmotic adjustment and should be able to distribute these ions internally to keep sodium away from the cytosol. The first transgenic approaches introduced genes that modulated cation-transport systems. Hence, transgenic tomato plants overexpressing a vacuolar Na+/H+ antiport were able to grow, flower, and produce fruits in the presence of 200 mM sodium chloride [117].

2 Genetically Modified Plants

Overexpression of the HAL1 gene from yeast in transgenic tomato plants had a positive effect on salt tolerance by reducing K+ loss and reducing intracellular Na+ from the cells under salt stress [118]. Genes conferring tolerance to low iron In the arid and semi-arid regions of the world, soils are alkaline in nature and, therefore, crop yields are limited by lack of available iron. Under iron stress, some plants release specific Fe(III)-binding compounds, known as siderophores, which bind the otherwise insoluble Fe(III) and transport it to the root surface. To increase the quantity of siderophores released under conditions of low iron availability, Takahashi et al. [119] transferred two barley genes (naat-A and naat-B) coding for the enzyme nicotianamine aminotransferase and the endogenous promoters into rice plants. When under iron stress transgenic rice plants excreted approximately 1.8 times more siderophore than wild-type rice plants. This relatively small increase enabled transgenic rice plants to withstand iron deprivation remarkably better, resulting in a fourfold increase in grain yield compared with the wild-type plants [119]. Alternatively, increasing the rate-limiting step of Fe(III) chelate reduction, which reduces iron to the more soluble Fe(II) form, might enhance iron uptake in alkaline soils [120]. Aluminum tolerance Aluminum toxicity is a major factor limiting crop productivity in acidic soils, which comprise about 40% of the world’s arable land. One of the most visible symptoms of aluminum toxicity is inhibition of root elongation. One possible mechanism of aluminum tolerance is the chelation of aluminum by organic ions, for example citrate or malate in the rhizosphere or within root cells. Overproduction of citrate has been shown to result in aluminum tolerance in transgenic tobacco, papaya, and oil-seed rape [121, 122]. Expression of the ALMT1 gene (aluminum-activated malate transporter) from wheat in transgenic barley plants resulted in high aluminum tolerance [123].

2.3.1.4 Improved Agronomic Properties Acceleration of sprouting time in the potato The ability to control sprouting time in potato tubers is of substantial economic importance to the potato industry. The potato industry currently uses a range of chemical treatments to achieve the desired control. To use a biotechnological approach, the pyrophosphatase gene from E. coli under the control of the tuber-specific patatin promoter was transferred into potatoes. The pyrophosphatase gene was chosen because of the central role of inorganic phosphate in starch degradation and sucrose biosynthesis. It is believed that starch breakdown and subsequent formation of a variety of metabolites is needed for growth of the sprout. Significantly accelerated sprouting was observed for transgenic potatoes – transgenic tubers sprouted on average six to seven weeks earlier than control tubers. After cold storage most transgenic tubers sprouted within one week whereas wildtype tubers needed eight weeks or more [124].

2.3 GM Plants “In the Pipeline”

Reduction of generation time in citrus trees Citrus trees have a long juvenile phase that delays their reproductive development by between six and twenty years. With the objective of accelerating flowering time, juvenile citrus seedlings were transformed with the Arabidopsis LEAFY (LFY) and APETALA (AP1) genes, which promote flower initiation in Arabidopsis. Both types of transgenic citrus produced fertile flowers as early as the first year. These traits are submitted to the offspring as dominant traits, generating trees with a generation time of one year from seed to seed [125]. Constitutive expression of LFY also promoted flower initiation in transgenic rice [126]. 2.3.2 Traits Affecting Food Quality for Human Nutrition

The sections below give examples of how the nutritional value of food crops can be improved by genetic engineering, although none of these genetically engineered food plants has yet reached the marketplace. In addition to the safety of the GMPs for health and environment, the effectiveness of this approach in comparison with alternative methods must be shown for these traits.

2.3.2.1 Increased Vitamin Content One of the most advanced projects to fortify food crops with vitamins is the socalled “golden rice”. To enable provitamin A biosynthesis in the rice endosperm, four additional enzymes are required. Immature rice embryos were co-transformed with two Agrobacterium constructs containing the psy and the lcy gene from daffodil, coding for phytoene synthase and lycopene β-cyclase, respectively, and the crtI gene from Erwinia uredovora, coding for a bacterial phytoen desaturase. Ten plants harboring all the transferred genes were recovered, and all showed a normal vegetative phenotype and were fertile. The transformed endosperms were usually yellow, indicating carotenoid formation [127]. After transfer of the new trait into locally best adapted varieties, either by traditional breeding or de-novo transformation, it is hoped that vitamin A deficiency in developing countries can be prevented [128]. In contrast with rice, tomato plants already produce carotenoids, and tomato products are viewed as the principal dietary source of lycopene and a major source of β-carotene. Because lycopene and β-carotene are regarded as beneficial to health (reducing chronic conditions such as coronary heart disease and some cancers), an attempt has been made to enhance the carotenoid content and profile of tomato fruits by genetic engineering. The bacterial carotenoid gene (crtI), which encodes for phytoene desaturase, has therefore been introduced into tomato plants. Transgenic plants had an increased β-carotene content (up to 45% of the total carotenoid content), although total carotenoid content was not elevated [129]. Regular uptake of vitamin C (ascorbic acid) is essential for humans, because they lack the ability to synthesize it. In plants, ascorbic acid can be regenerated from its oxidized form in a reaction catalyzed by dehydroascorbate reductase (DHAR).

2 Genetically Modified Plants

Overexpression of a DHAR cDNA from wheat in maize and tobacco led to a two to fourfold increase in ascorbic acid levels in foliage and kernels [130].

2.3.2.2 Production of Very-long-chain Polyunsaturated Fatty Acids Very-long-chain polyunsaturated fatty acids (VLCPUFAs), for example arachidonic, icasopentaenoic, or docosahexaenoic acid, have important roles in human health and nutrition. They are components of membrane phospholipids, precursors of prostaglandins, required for the development of the fetal neuronal system, and are reported to reduce the incidence of cardiovascular diseases. The diet of most modern societies is relatively low in ω3-PUFAs, with a concomitant increased level of ω6-PUFA intake. Oily fish are an important source of VLCPUFAs whereas not all plant oils contain VLCPUFAs. First results have been obtained from attempts to genetically engineer the capacity to synthesize these fatty acids in oilseed species. The seed-specific expression of cDNAs encoding fatty acid acyl-desaturases and elongases resulted in the accumulation of up to 5% of VLCPUFAs in linseed [131].

2.3.2.3 Increased Iron Level Because cereal grain is deficient in some essential mineral nutrients, including iron, several approaches have been used to increase iron accumulation and alter iron metabolism. Because ferritin is a general iron-storage protein in all living organisms, ferritin genes have been introduced into rice and wheat plants. Goto et al. [132] generated transgenic rice plants expressing soybean ferritin under the control of the seed-specific rice Glu-B1 promoter. Transgenic rice seeds accumulated up to three times more iron than wild-type seeds [132]. Likewise, increased iron levels were found in transgenic rice seeds expressing bean ferritin under the control of the related Gt-1 promoter [133]. Two approaches have been used not only to increase iron accumulation but also improve its absorption in the human intestine. First, the level of the main inhibitor of iron absorption, phytic acid, has been reduced by introduction of a heat-tolerant phytase from Aspergillus fumigatus. Transgenic rice plants had at least twice the phytase activity whereas in one individual transgenic line phytase activity in the grain increased approximately one-hundred and thirtyfold. Second, because cysteine peptides are regarded as a major enhancer of iron absorption, the endogenous cysteine-rich metallothionein-like protein gene (rgMT) was overexpressed and the cysteic acid content increased significantly in transgenic seeds. The authors suggested that high-phytase rice, with a increased iron content and rich in cysteine-peptide, has the potential to greatly improve iron supply for rice-eating populations [133, 134].

2.3.2.4 Improved Amino Acid Composition Potatoes contain limited amounts of the essential amino acids lysine, tryptophan, methionine, and cysteine. To improve the nutritional value of potatoes a nonal-

2.3 GM Plants “In the Pipeline”

lergenic seed albumin gene (AmA1) from Amaranthus hypochondriacus has been transferred to potato plants. The seed-specific albumin was under the control of a tuber-specific or a constitutive promoter. In both transgenic lines a 35–45% increase in total protein content was reported in transgenic tubers; this corresponded to an increase in the most essential amino acids. A twofold increase in tuber number and a 3.0 to 3.5-fold increase in tuber yield were also observed [135].

2.3.2.5 Reduction in the Amount of Antinutritive Factors Cassava is one of the few plants in nature that contains toxic cyanogenic glycosides in the leaves and roots. Sufficient processing of the harvested roots normally renders the cassava safe, although the processing which renders toxic cassava varieties safe also removes some nutritional value. Moller et al. isolated the genes responsible for cyanogenic glycoside production and are now transforming cassava with anti-sense constructs of the respective genes CYP79D1 and CYP79D2 [136]. Another strategy for reducing the cyanide toxicity of cassava roots is to introduce a gene that codes for the enzyme hydroxynitrile lyase (HNL). This enzyme breaks down the major cyanogen acetone cyanohydrin, and is expressed only in the leaves. After transformation of the cDNA encoding HNL, HNL activity in cassava roots was comparable with that in leaves. Field trials will determine whether expression of HNL in roots reduces the cyanide toxicity of cassava food products [137, 138].

2.3.2.6 Production of “Low-calorie Sugar” Koops and coworkers have developed a new sugar beet that produces fructan, a low-calorie sweetener, by inserting a single gene from Jerusalem artichoke that encodes an enzyme for converting sucrose to fructan (1-sucrose:sucrose fructosyl transferase [1-sst]). Short-chain fructans have the same sweetness as sucrose, but provide no calories because humans lack the fructan-degrading enzymes necessary to digest them. Longer-chain fructans form emulsions with a fat-like texture, and fructans also promote the growth of beneficial bacteria present in the gut. Transgenic sugar beet roots produce the same amount of total sugar, but expression of the 1-sst gene resulted in conversion of more than 90% of the stored sucrose into fructans. Under greenhouse conditions, the “fructan beets” developed normally and their root dry weight was almost the same as that of normal sugar beet. The yield of 110 μmol g−1 freshweight of fructan makes extraction of these compounds of economic interest [139].

2.3.2.7 Seedless Fruits and Vegetables In plants able to develop fruits without fertilization (parthenocarpic fruits), the seeds are absent – a feature that can increase fruit acceptance by consumers. To achieve parthenocarpic development, it is common practice to treat flower buds with synthetic auxinic hormones. To mimic the hormonal effects by genetic engineering, the expression of a gene able to increase auxin content and activity should

2 Genetically Modified Plants

be induced in the ovule. Rotino and coworkers [140] used the iaaM gene from Pseudomonas syringae pv. savastanoi under control of an ovule-specific promoter (DefH9) from Antirrhinum majus to induce parthenocarpic development in transgenic tobacco and eggplants. In transgenic eggplants, fruit setting took place even under environmental conditions prohibitive for the untransformed line. Fruit size and weight were similar to those obtained by pollination in transgenic and control plants [140]. It was envisaged that this approach might also be valuable in other horticultural species, for example pepper and tomatoes, in which fruit quality is susceptible to uneven pollination and seed set during lower temperature fluctuations associated with “winter season” production. A similar approach might also be used to produce seedless watermelons rather than the cumbersome triploid seed production system now employed [141].

2.3.3 Traits that Affect Processing 2.3.3.1 Altered Gluten Level in Wheat to Change Baking Quality The bread-making quality of wheat flour depends primarily on the presence of high-molecular-weight (HMW) glutenins. Wheat is unique among cereals in having this property. The glutenin proteins are encoded by six genes, and the total glutenin content of the grain is proportional to the expression of these genes. It has been shown that the quality of dough can be affected by both the quantity and quality of the expressed genes. When specific glutenin genes were added back to wheat lines missing some of the glutenin genes, the dough-mixing characteristics were improved significantly [142]. This same technique could be applied to wheat lines that have already been optimized for baking, and could result in flour with glutenin levels higher than the current maximum of 10% of total protein [143]. The quality of durum wheat (Triticum turgidum L. var. durum) for bread and pasta making has also been modified by insertion of HMW glutenin subunit genes [144].

2.3.3.2 Altered Grain Composition in Barley to Improve Malting Quality β-Glucan is the major constituent of the cell wall of the starchy endosperm of barley. These cell wall molecules are very large, water-soluble, and produce viscous worts if not sufficiently reduced in size by hydrolysis. This leads to slow filtration of wort and beer, and glucan precipitate in the finished product. β-Glucan hydrolysis is likely to be a function of the level of (1-3,1-4)-β-glucanase produced by the aleurone, and how much of the enzyme survives high-temperature kilning and mashing. Doubling the amount of β-glucanase activity is likely to ensure sufficient β-glucan hydrolysis, and this could be achieved either by increasing the amount of enzyme synthesized or by changing the heat stability of β-glucanase [145]. The latter has been achieved by transferring a fungal thermotolerant endo-1,4-β-glucanase to two barley cultivars. The amount of heterologous enzyme has been shown to be sufficient to reduce wort viscosity by reducing the soluble β-glucan content [146].

2.3 GM Plants “In the Pipeline”

In another approach, biochemically active wheat thioredoxin h has been overexpressed in the endosperm of transgenic barley grain. Such overexpression in germinated grain effected an up to fourfold increase in the activity of the debranching enzyme pullulanase, a rate-limiting enzyme in the breakdown of starch. The breakdown of starch is a key step in the malting process, and tests with transgenic varieties showed that the time required could be reduced by up to a day [147, 148].

2.3.4 Traits of Pharmaceutical Interest

2.3.4.1 Production of Vaccines Vaccines are designed to elicit an immune response without causing disease. Typical vaccines comprise killed or attenuated disease-causing organisms; recombinant vaccines are desirable as an alternative because they usually cause fewer sideeffects than occur when the whole organism is delivered. Many candidate proteins have been identified that may function as effective subunit vaccines. Currently, the most common large-scale production of recombinant proteins are genetically engineered bacteria and yeast, because of the ease of manipulation and their rapid growth. Recombinant proteins overexpressed in microorganisms must be extensively purified, however, to remove host proteins and compounds. Transgenic plants are an alternative system, with the great practical advantage of producing directly an edible plant tissue for oral immunization. In addition, edible plantbased recombinant vaccines are safe, provide nutrition, and are easy to administer [149, 150]. Much research is currently focused on understanding transgene expression, stability, and processing in plants. Typical experiments investigating in-plant protein expression employ plant model systems such as potato, tomato, and maize. The ideal plant for human vaccination would be bananas, because they are readily eaten by babies, are consumed uncooked, and are indigenous to many developing countries. Because regeneration and growth to maturity can take up to three years in bananas, it is necessary to optimize high-level expression of a vaccine antigen in model plants [150]. For viral infections, virus-like particles (VLPs), which form by self-assembly of viral surface proteins, are effective as vaccines. The hepatitis B surface antigen (HbsAg) has successfully been used as a vaccine against hepatitis B virus. The vaccine was first produced in yeast by Merck and SmithKline Beecham, and was the first recombinant subunit vaccine. It thus served as a model for the first attempt to produce a plant-based vaccine. HbsAg was expressed in tobacco and potato plants and shown to assemble into VLPs similar to the yeast-derived commercial vaccine [151, 152]. In the United States, preliminary clinical trials have been performed, and a good systemic response was observed for two out of three volunteers who ate transgenic

2 Genetically Modified Plants

lettuce carrying a hepatitis B antigen. Likewise, an immune response was observed for 19 of 20 people who ate a potato vaccine aimed at the Norwalk virus [153]. Mice fed with potato plants transgenic for a cholera toxin B subunit gene (CTB) developed immunity against the bacterial endotoxin [149]. Currently, clinical trials with a plant-based vaccine against a bacterial pathogen are under way in the United States. Arntzen and colleagues inserted a gene for part of an Escherichia coli enterotoxin (LT-B subunit gene) that caused diarrhea in humans into potato plants, and all but one of the 11 volunteers who ate the transgenic raw potatoes produced antibodies to the toxin [154]. A common problem of vaccine antigens expressed in plants has been the low level of expression. In LT-B-expressing plants this has been overcome by using a “plant codon usage optimized” synthetic gene encoding LT-B and the use of the tuber-specific patatin promoter (Mason et al., 1998, cited in Ref. [150]). Future considerations must include containment of the transgenes and quality control for antigen content. These considerations are particularly important, because inappropriate dosing of vaccines can impair their effectiveness and constant dosing can lead (potentially) to immunological tolerance [150]. In more recent discussion the feasibility of direct oral immunization by eating transgenic plants was doubted because of poor lot-to-lot consistency; processing to pills prescribed by doctors was favored.

2.3.4.2 Production of Pharmaceuticals Some recombinant proteins are already available commercially, including human erythropoietin or glucocerebrosidase. Until now, commercial production has used E. coli, yeast, or mammalian cells for fermentation. These expression systems have limitations, however: bacteria cannot perform the complex post-translational modifications required for bioactivity of many human proteins, and production of proteins such as growth regulators or cell-cycle inhibitors would negatively affect the transgenic animal cell culture [155]. Plants have several advantages compared with traditional systems for molecular farming of pharmaceutical proteins. These include: 1. low production costs; 2. reduced time to market; 3. unlimited supply; 4. eukaryotic protein processing; and 5. safety from blood or animal tissue-borne human pathogens [156]. Production of a range of therapeutic proteins in transgenic plants has proven their capability for production of bioactive human proteins of pharmaceutical value–the proteins seem to be fully functional and structurally comparable with the analogous proteins produced in animal cell culture [155]. Examples of human therapeutic proteins include serum proteins, for example hemoglobin, as blood substitute, interferons as viral protection agents, lysosomal enzymes lacking in patients with Gaucher or Fabry disease, and other proteins, for

2.3 GM Plants “In the Pipeline”

example hirudin, which is effective as an anticoagulant (a summary of this work has been published elsewhere [157]). Most of these pharmaceuticals are produced in model plants that are easy to transform, for example tobacco and potato, by using the constitutive 35S promoter from the cauliflower mosaic virus. Because high levels of protein accumulation may negatively affect yield and/or growth of the transgenic plants, however, inducible or tissue-specific promoters are preferable [157]. Tobacco is an excellent biomass producer, but does produce toxic compounds. Crop-based production systems (e.g. wheat, rice, corn) lack these toxic substances and provide an existing infrastructure for their cultivation, harvest, distribution, and processing [158]. This makes food crops highly attractive but leads to the potential for the unintended presence of therapeutic proteins in human food. Recently publicized incidents in which genetically modified crops have been inadvertently mixed with those destined for human consumption have highlighted the need for mechanisms to ensure the segregation of plants that express pharmaceutical products. Cereal crops (rice and wheat) were first used as production and storage system for a single-chain antibody against carcinoembryogenic antigen (CEA), a wellcharacterized tumor-associated marker antigen. The antibodies could be stored in dried seeds for at least five months without significant loss of activity of the antibody [159]. An alternative technique employs targeting of the recombinant protein to the oil bodies of Brassica napus seeds. A synthetic gene coding for a hirudin variant was fused to an Arabidopsis oleosin gene and transferred to oil-seed rape. The recombinant hirudin was correctly targeted and accumulated on the oil bodies of transgenic seeds which, because of their lower density could easily be separated by flotation centrifugation. The functional biopharmaceutical was then released by protease treatment [160]. Recent work has revealed the potential for producing recombinant proteins in the guttation fluid of tobacco. Guttation, which is the loss of water and dissolved materials from uninjured plant organs, leads to the production of guttation fluid. This can be collected throughout the plant’s life, thereby providing a continuous and nondestructive system for recombinant protein production [161].

2.4 Outlook

It is likely that rapid development of molecular and technological methods will occur in the future, and that this will include the initial development of new transgenic approaches in model plants such as Arabidopsis, then transfer of ready-established methods to most crop plants. The combination of genetic engineering and molecular marker technology with conventional crossings and subsequent selection will enable a rapid progress in plant breeding. Despite these possibilities, limitations of widespread application can be foreseen in the patent situation, and this will lead to a partial unpredictability in production

2 Genetically Modified Plants

costs. One hindrance to worldwide trade – and therefore also to the marketability of genetically modified foods – is different legal regulations, e.g. in the USA and Europe. Lack of acceptance by the public of genetically modified food, especially in central Europe, might also delay the commercial exploitation of transgenic plants, even when there might be advantages for the consumer.

References 1 Hansen, G., Chilton, M. D. 1999. Lessons in Gene Transfer to Plants by a Gifted Microbe. In: Hammond, J., McGarvey, P., Yushibov, V. (eds.), Plant Biotechnology: New Products and Applications, Springer, Berlin, New York, 21–58. 2 Hammond, J. 1999. Overview: The Many Uses and Applications of Transgenic Plants. In: Hammond, J., McGarvey, P., Yushibov, V. (eds.), Plant Biotechnology: New Products and Applications, Springer, Berlin, New York, 1–20. 3 Dai, S., Zheng, P., Marmey, P., Zhang, S., Tian, W., Chen, S., Beachy, R. N., Fauquet, C. 2001. Comparative analysis of transgenic rice plants obtained by Agrobacterium-mediated transformation and particle bombardment. Mol. Breeding 7 (1):25–33. 4 Arencibia, A. D., Carmona, E. R., Tellez, P., Chan, M.-T., Yu, S.-M., Trujillo, L. E., Oramas, P. 1998. An efficient protocol for sugarcane (Saccharum spp. L.) transformation mediated by Agrobacterium tumefaciens. Transgenic Res. 7:213–222. 5 Potrykus, I. 1995. Direct Gene Transfer to Protoplasts. In: Potrykus, I. and Spangenberg, G. (eds.), Gene Transfer to Plants. Springer Lab Manual, Berlin, 55–57. 6 Arencibia, A. D., Carmona, E. R., Cornide, M. T., Castiglione, S., O’Reilly, J., Chinea, P., Oramas, P., Sala, F. 1999. Somaclonal variation in insect-resistant sugarcane (Saccharum hybrid) plants produced by electroporation. Transgenic Res. 8:349–360. 7 Sanford, J. C., Klein, T. M., Wolf, E. D., Allen, N. 1987. Delivery of substances into cells and tissues using a particle bombardment process. J. Part. Sci. Tech. 5:27–37. 8 Finer, J. J., Finer, K. R., Ponappa, T. 1999. Particle Bombardment Mediated Transformation. In: Hammond, J., McGarvey,

P., Yushibov, V. (eds.), Plant Biotechnology: New Products and Applications, Springer, Berlin, New York, 59–80. Fütterer, J. 1995. Genetic Markers and Expression Signals. In: Potrykus, I. and Spangenberg, G. (eds.), Gene Transfer to Plants. Springer Lab Manual, Berlin, 311–324. Wang, Y., Zhang, W., Cao, J., McElroy, D., Wu, R. 1992. Characterization of cis-acting elements regulating transcription from the promoter of a constitutively active rice actin gene. Mol. Cell. Biol. 12:3399–3406. Christensen, A. H., Sharrock, R. A., Quail, R. H. 1992. Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol. Biol. 18:675–689. McElroy, D., Brettell, R. I. S. 1994. Foreign gene expression in transgenic cereals. Trends Biotechnol. 12:62–68. Fujimoto, H., Yamamoto, M., Kyozuka, J, Shimamoto, K. 1993. Insect-resistant rice generated by introduction of a modified δ-endotoxin gene from Bacillus thuringiensis. Bio/Technology 11:1151–1155. Schrott, M. 1995. Selectable Marker and Reporter Genes. In: Potrykus, I. and Spangenberg, G. (eds.), Gene Transfer to Plants. Springer Lab Manual, Berlin, 325–336. Collard, J.-M. 1999. Aminoglycoside resistance. http://www.antibioresistance. be/aminoglycosides.html (accessible August 2005). Moens, W., Collard, J.-M. 2002. GM Plants containing antibiotic resistance genes. http://www.biosafety.be/ARGMO/ GMO_Plants.html (accessible August 2005).

References 17 De Block, M., Botterman, J., Vandewiele, M., Dockx, J., Thoen, C., Gossele, V., Movva, N. R., Thompson, C., Van Montague, M., Leemans, J. 1987. Engineering herbicide resistance in plants by expression of a detoxifying enzyme. EMBO J. 6:2513–2518. 18 Anonymus (2000) University of Toronto, Eucaryotic Molecular Biology, Genetically Modified Foods Project, Herbicide resistance. http://dragon.zoo.utoronto. ca/~jlm-gmf/T0201A/herb1.htm (accessible August 2005) 19 Jefferson, R. A., Kavanagh, T. A., Bevan, M. W. 1987. GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6:39001–3908. 20 Ow, D. W., Wood, K. V., DeLuca, M., de Wet, J. R., Helinski, D. R., Howell, S. H. 1986. Transient and stable expression of the firefly luciferase gene in plant cells and transgenic plants. Science 234:856– 859. 21 Millar, A. J., Short, S. R., Hiratsuka, K., Chua, N. H., Kay, S. A. 1992. Firefly luciferase as a reporter of regulated gene expression in higher plants. Plant Mol. Biol. Rep. 10:324–337. 22 Stirn, S. 2000. Antibiotic resistance and horizontal gene transfer. In: GTZ (Gesellschaft für Technische Zusammenarbeit) (ed.), Development of Frame Conditions for the Utilisation of Biotechnology and Genetic Engineering. http://www2.gtz. de/biotech/dokumente/biotech5.pdf (accessible August 2005). 23 Kunkel, T., Niu, Q.-W., Chan, Y.-S., Chua, N.-H. 1999. Inducible isopentenyl transferase as a high-efficiency marker for plant transformation. Nature Biotechnol. 17: 916–919. 24 Joersbo, M., Donaldson, I., Petersen, S. G., Brunstedt, J., Okkels, F. T. 1998. Analysis of mannose selection used for transformation of sugar beet. Mol. Breeding 4:111–117. 25 Odell, J. T., Russell, S. H. 1994. Use of Site-Specific Recombination Systems in Plants. In: Paszkowski J. (ed.), hom*ologous Recombination and Gene Silencing in Plants. Kluwer Academic Publ., Netherlands, 219–270.

26 Schiemann, J., Weber, A., Hassa, A. 1998. Überprüfung von Konzepten zur nachträglichen Fremdgen-Eliminierung aus transgenen Pflanzen. In: Jahresbericht der Biologischen Bundesanstalt für Land- und Forstwirtschaft 1998, Berlin und Braunschweig, Abstract Nr. 189. 27 Zuo, J., Niu, Q.-W., Møller, S. G., Chua, N.-H. 2001. Chemical-regulated, site-specific DNA excision in transgenic plants. Nature Biotechnol. 19:157–161. 28 Zubko, E., Scutt, C., Meyer, P. 2000. Intrachromosomal recombination between attP regions as a tool to remove selectable marker genes from tobacco transgenes. Nature Biotechnol. 18:442–445. 29 Puchta, H. 2000. Removing selectable marker genes: taking the short cut. Trends Plant Sci. 5 (7):273–274. 30 Transgen (Transparenz für Gentechnik bei Lebensmitteln) 2005. Gentechnisch veränderte Pflanzen: Zulassungspraxis EU. http://www.transgen.de/zulassung (data from Mai 2005). 31 AGBIOS (Agriculture and Biotechnology Strategies (Canada) Inc.) 2005. Biotech Crop Database. http://www.agbios.com/ dbase.php?action=ShowForm (data from August 2005). 32 ISAAA (International Service for the Acquisition of Agri-biotech Applications) 2005. Preview: Global Status of Commercialized Biotech/GM Crops: 2004. http://www.isaaa.org/kc/CBTNews/pressrelease/breifs32/ESummary/Executive Summary (English).pdf (August 2005) 33 Transgen 2002. Anbauflächen gentechnisch veränderter Pflanzen 2001. http:// www.transgen.de/Aktuell/ISAAA_2001_ preview.html (data from January 2005). 34 Cheng, X., Sardana, R., Kaplan, H., Altosaar, I. 1998. Agrobacterium-transformed rice plants expressing synthetic cryIA(b) and cryIA(c) genes are highly toxic to striped stem borer and yellow stem borer. Proc. Natl. Acad. Sci. USA 95:2767–2772. 35 Tu, J., Zhang, G., Datta, K., Xu, C., He, Y., Zhang, Q., Khush, G. S., Datta, S. K. 2000. Field performance of transgenic elite commercial hybrid rice expressing Bacillus thurigiensis δ-endotoxin. Nature Biotechnol. 18:1101–1104.

2 Genetically Modified Plants 36 Stewart, C. N., Adang, M. J., All, J. N., Boerma, H. R., Cardineau, G., Tucker, D., Parrott, W. A. 1996. Genetic transformation, recovery, and characterization of fertile soybean transgenic for a synthetic Bacillus thuringiensis cryIAc gene. Plant Physiol. 112 (1):121–129. 37 Stewart, C. N., Adang, M. J., All, J. N., Raymer, P. L., Ramachandran, S., Parrott, W. A. 1996b. Insect control and dosage effects in transgenic canola containing a synthetic Bacillus thuringiensis cryIAc gene. Plant Physiol. 112 (1):115–120. 38 Arpaia, S., Mennella, G., Onofaro, V., Perri, E., Sunseri, F., Rotino, G. L. 1997. Production of transgenic eggplant (Solanum melongena L.) resistant to Colorado Potato Beetle (Leptinotarsa decemlineata Say). Theoret. Appl. Genet. 95:329–334. 39 USDA (United States Department of Agriculture) 2002. Field tests release database for the U.S.. http://www.isb. vt.edu/cfdocs/fieldtests1.cfm (data from August 2005). 40 EPA (Environmental Protection Agency, USA) 2001. Biopesticides Federal Register Notices – 2005. http://www.epa.gov/ pesticides/biopesticides/regtools/frnotices2005.htm (data from June 2005). 41 Moellenbeck, D. J., Peters, M. L., Bing, J. W. et al. 2001. Insecticidal proteins from Bacillus thuringiensis protect corn from corn root worms. Nature Biotechnol. 19:668–672. 42 Gatehouse, A. M. R., Hilder, V. A., Powell, K. S., Wang, M., Davison, G. M., Gatehouse, L. N., Down, R. E., Edmonds, H. S., Boulter, D., Newell, C. A., Merryweather, A., Hamilton, W. D. O., Gatehouse, J. A. 1994. Insect-resistant transgenic plants: choosing the gene to do the ‘job’. Biochem. Soc. Trans. 22:944–949. 43 Marchetti, S., Delledonne, M., Fogher, C., Chiabà, C., Chiesa, F., Savazzini, F., Giordano, A. 2000. Soybean Kunitz, C-II and PI-IV inhibitor genes confer different levels of insect resistance to tobacco and potato transgenic plants. Theoret. Appl. Genet. 101: 519–526. 44 Rao, K. V., Rathore, K. S., Hodges, T. K., Fu, X., Stoger, E., Sudhakar, D., Williams, S., Christou, P., Bharathi, M., Bown, D. P., Powell K. S., Spence, J., Gatehouse, A. M. R., Gatehouse, J. A. 1998. Expression

of snowdrop lectin (GNA) in transgenic rice plants confers resistance to rice brown planthopper. Plant J. 15(4): 469–477. Ewen, S. W. B., Pusztai, A. 1999. Effects of diets containing genetically modified potatoes expressing Galanthus nivalis lectin on rat small intestine. Lancet 354:1353–1354. Kuiper, H. A., Noteborn, H. P. J. N., Peijenburg, A. A. C. M. 1999. Adequacy of methods for testing the safety of genetically modified food. Lancet 354:1315– 1316. Morton, R. L., Schroeder, H. E., Bateman, K. S., Chrispeels, M. J., Armstrong, E,. Higgins, T. J. 2000. Bean alpha-amylase inhibitor 1 in transgenic peas (Pisum sativum) provides complete protection from pea weevil (Bruchus pisorum) under field conditions. Proc. Natl. Acad. Sci. USA 97(8):3820–3835. Kramer, K. J., Morgan, T. D., Throne, J. E., Dowell, F. E., Bailey, M., Howard, J. A. 2000. Transgenic avidin maize is resistant to storage insect pests. Nature Biotechnol. 18: 670–674. Hayakawa, T., Zhu, Y., Itoh, K., Izawa, T., Shimamaoto, K., Toriyama, S. 1992. Genetically engineered rice resistant to rice stripe virus, an insect-transmitted virus. Proc. Natl. Acad. Sci. USA 89 (20):9865–9869. Ravelonandro, M., Scorza, R., Bachelier, J. C., Labonne, G., Levy, L., Damsteegt, V., Callahan, A. M., Dunez, J. 1997. Resistance of transgenic Prunus domestica to plum pox virus infection. Plant Dis. 81: 1231–1235. Kaniewski, W., Ilardi, V., Tomassoli, L., Mitsky, T., Layton, J., Barba, M. 1999. Extreme resistance to cucumber mosaic virus (CMV) in transgenic tomato expressing one or two viral coat proteins. Mol. Breeding 5:111–119. Chowrira, G. M., Cavileer, T. D., Gupta, S. K., Lurquin, P. F., Berger, P. H. 1998. Coat-protein-mediated resistance to pea enation mosaic virus in transgenic Pisum sativum L. Transgenic Res. 7:265–271. Magbanua, Z. V., Wilde, H. D., Roberts, J. K., Chowdhury, K., Abad, J., Moyer, J. W., Wetzstein, H. Y., Parrott, W. A. 2000. Field resistance to tomato spotted wilt virus in transgenic peanut (Arachis

References

hypogaea L.) expressing an antisense nucleocapsid gene sequence. Mol. Breeding 6:227–236. Koev, G., Mohan, B. R., Dinesh-Kumar, S. P., Torbert, K. A., Somers, D. A., Miller, W. A. 1998. Extreme reduction of disease in oats transformed with the 5’ half of the barley yellow dwarf virus-PAV genome. Phytopathology 88:1013–1019. Gal-On, A., Wang, Y., Faure, J. E., Pilowsky, M., Zelcer, A. 1998. Transgenic resistance to cucumber mosaic virus in tomato: blocking of long-distance movement of the virus in lines harbouring a defective viral replicase. Phytopathology 88 (10):1101–1107. Huet, H., Mahendra, S., Wang, J., Sivamani, E., Ong, C. A., Chen, L., de Kochko, A., Beachy, R. N., Fauquet, C. 1999. Near immunity to rice tungro spherical virus achieved in rice by replicase-mediated resistance strategy. Phytopathology 89: 1022–1027. Sivamani, E., Brey, C. W., Dyer, W. E., Talbert, L. E., Qu, R. 2000. Resistance to wheat streak mosaic virus in transgenic wheat expressing the viral replicase (Nib) gene. Mol. Breeding 6:469–477. Valanzuolo, S., Catello, S., Colombo, M., Dani, M., Monti, M. M., Uncini, L., Petrone, P., Spingo, P. 1994. Cucumber Mosaic Virus resistance in transgenic San Marzano tomatoes. Acta Horticulturae 376:377–386. Stommel, J. R., Tousignant, M. E., Wai, T., Pasini, R., Kaper, J. M. 1998. Viral satellite RNA expression in transgenic tomato confers field tolerance to cucumber mosaic virus. Plant Dis. 82 (4):391–396. Tepfer, M. 1993. Viral genes and transgenic plants. Bio/Technology 11:1125– 1132. Lodge, J. K., Kaniewski, W. K., Tumer, N. E. 1993. Broad-spectrum resistance in transgenic plants expressing pokeweed antiviral protein. Proc. Natl. Acad. Sci. USA 90:7089–7093. Wang, P., Zoubenko, O., Tumer, N. E. 1998. Reduced toxicity and broad spectrum resistance to viral and fungal infection in transgenic plants expressing pokeweed antiviral protein II. Plant Mol. Biol. 38:957–964.

63 Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A., Galeffi, P. 1993. Transgenic plants expressing a functional single-chain Fv antibody are specifically protected from virus attack. Nature 366:469–472. 64 Xiao, X. W., Chu, P. W. G., Frenkel, M. J., Tabe, L. M., Shukla, D. D., Hanna, P. J., Higgins, T. J. V., Müller, W. J., Ward, C. W. 2000. Antibody-mediated improved resistance to CIYVV and PVY infections in transgenic tobacco plants expressing a single-chain variable region antibody. Mol. Breeding 6: 421–431. 65 Mitsuhara, I., Matsufuru, H., Ohshima, M., Kaku, H., Nakajima, Y., Murai, N., Natori, S., Ohashi, Y. 2000. Induced expression of sarcotoxin IA enhanced host resistance against both bacterial and fungal pathogens in transgenic tobacco. Mol. Plant–Microbe Interact. 13 (8):860–868. 66 Lin, W., Anuratha, C. S., Datta, K., Potrykus, K., Muthukrishnan, S., Datta, S. K. 1995. Genetic engineering of rice for resistance to sheath blight. Bio/Technology 13:686–691. 67 Datta, K., Velazhahan, R., Oliva, N., Ona, I., Mew, T., Khusgh, G. S., Muthukrishnan, S., Datta, S. K. 1999. Over-expression of the cloned rice thaumatin-like protein (PR-5) gene in transgenic rice plants enhances environmental friendly resistance to Rhizoctonia solani causing sheath blight. Theoret. Appl. Genet. 98: 1138–1145. 68 Datta, K., Tu, J. M., Oliva, N., Ona, I., Velazhahan, R., Mew, T. W., Muthukrishnan, S., Datta, S. K. 2001. Enhanced resistance to sheath blight by constitutive expression of infection-related rice chitinase in transgenic elite indica rice cultivars. Plant Sci. 160 (3):405–414. 69 Nishizawa, Y., Nishio, Z., Nakazono, K., Soma, M., Nakajima, E., Ugaki, M., Hibi, T. 1999. Enhanced resistance to blast (Magnaporthe grisea) in transgenic Japonica rice by constitutive expression of rice chitinase. Theoret. Appl. Genet. 99 (3/4):383–390. 70 Schaffrath, U., Mauch, F., Freydell, E., Schweizer, P., Dudler, R. 2000. Constitutive expression of the defense-related Rir1b gene in transgenic rice plants confers enhanced resistance to the rice

2 Genetically Modified Plants

blast fungus Magnaporthe grisea. Plant Mol. Biol. 43:59–66. Dixon, R. A., Lamb, C. J., Masoud, S., Sewalt, V. J. H., Paiva, N. L. 1996. Metabolic engineering: prospects for crop improvement through the genetic manipulation of the phenylpropanoid biosynthesis and defense responses – a review. Gene 179 (1):61–71. Tabei, Y., Kitade, S., Nishizawa, Y., Kikuchi, N., Kayano, T., Hibi, T., Akutsu, K. 1998. Transgenic cucumber plants harbouring a rice chitinase gene exhibit enhanced resistance to gray mold (Botrytis cinerea). Plant Cell Rep. 17 (3):159–164. Wang Y., Nowak, G., Culley, D., Hadwiger, L. A., Fristensky, B. 1999. Constitutive expression of pea defense gene DRR206 confers resistance to blackleg (Leptoshaeria maculans) disease in transgenic canola (Brassica napus). Mol. Plant–Microbe Interact. 12 (5):410–418. Tabaeizadeh, Z., Agharbaoui, Z., Harrak, H., Poysa, V. 1999. Transgenic tomato plants expressing a Lycopersicon chilense chitinase gene demonstrate improved resistance to Verticillium dahliae race 2. Plant Cell Rep. 19 (2): 197–202. Bliffeld, M., Mundy, J., Potrykus, I., Fütterer, J. 1999. Genetic engineering of wheat for increased resistance to powdery mildew disease. Theoret. Appl. Genet. 98 (6/7): 1079–1086. Chen, W. P., Chen, P. D., Liu, D. J., Kynast, R., Friebe, B., Velazhahan, R., Muthukrishnan, S., Gill, B. S. 1999. Development of wheat scab symptoms is delayed in transgenic wheat plants that constitutively express a rice thaumatinlike protein gene. Theoret. Appl. Genet. 99 (5):755–760. Oldach, K., Becker, D., Lörz, H. 2001. Heterologous expression of genes mediating enhanced fungal resistance in transgenic wheat. Mol. Plant–Microbe Interact. 14 (7):832–838. Yamamoto, T., Iketani, H., Ieki, H., Nishizawa, Y., Notsuka, K., Hibi, T., Hayashi, T., Matsuta, N. 2000. Transgenic grapevine plants expressing a rice chitinase with enhanced resistance to fungal pathogens. Plant Cell Rep. 19 (7):639–646. fa*goaga, C., Rodrigo, I., Conejero, V., Hinarejos, C., Tuset, J. J., Arnau, J., Pina,

J. A., Navarro, L., Pena, L. 2001. Increased tolerance to Phytophthora citrophthora in transgenic orange plants constitutively expressing a tomato pathogenesis related protein PR-5. Mol. Breeding 7 (2):175–185. Maddaloni, M., Forlani, F., Balmas, V., Donini, G., Stasse, L., Corazza, L., Motto, M. 1997. Tolerance to the fungal pathogen Rhizoctonia solani AG4 of transgenic tobacco expressing the maize ribosome inactivating protein b-32. Transgenic Res. 6 (6):393–402. Hain, R., Reif, H. J., Krause, E., Langbartels, R., Kindl, H., Vornam, B., Wiese, W., Schmelzer, E., Schreier, P. H., Stocker, R. H., Stenzel, K. 1993. Disease resistance results from foreign phytoalexin expression in a novel plant. Nature 361:153–156. Stark-Lorenzen, P., Nelke, B., Hanssler, G., Mühlbach, H.-P., Thomzik, J. E. 1997. Transfer of a grapevine stilbene synthase gene to rice (Oryza sativa L.). Plant Cell Rep. 16 (10):668–673. Leckband, G., Lörz, H. 1998. Transformation and expression of a stilbene synthase gene of Vitis vinifera L. in barley and wheat for increased fungal resistance. Theoret. Appl. Genet. 96 (8):1004–1012. He, X. Z., Dixon, R. A. 2000. Genetic manipulation of isoflavone 7-O-methyltransferase enhances biosynthesis of 4’-O-methylated isoflavonoid phytoalexins and disease resistance in alfalfa. Plant Cell 12 (9):1689–1702. Gandikota, M., de Kocho, A., Chen, L., Ithal, N., Fauquet, C., Reddy, A. R. 2001. Development of transgenic rice plants expressing maize anthocyanin genes and increased blast resistance. Mol. Breeding 7 (1):73–83. Takaichi, M., Oeda, K. 2000. Transgenic carrots with enhanced resistance against two major pathogens, Erysiphe heraclei and Alternaria dauci. Plant Sci. 153:135– 144. Lorito, M., Woo, S. L., Fernandez, I. G., Colucci, G., Harman, G. E., Pintor-Toro, J. A., Filippone, E., Muccifora, S., Lawrence, C. B., Zoina, A., Tuzun, S., Scala, F. 1998. Genes from mycoparasitic fungi as source for improving plant resistance to fungal pathogens. Proc. Natl. Acad. Sci. USA 95:7860–7865.

References 88 Bolar, J. P., Norelli, J. L., Wong, K. W., Hayes, C. K., Harman, G. E., Aldwinckle, H. S. 2000. Expression of endochitinase from Trichoderma harzianum in transgenic apple increases resistance to apple scab and reduces vigor. Phytopathology 90:72–77. 89 Clausen, M., Kräuter, R., Schachermayr, G., Potrykus, I., Sautter, C. 2000. Antifungal activity of a virally encoded gene in transgenic wheat. Nature Biotechnol. 18:446–449. 90 Husemann, M., Oldendorf, S., Schütte, G. 2001. Krankheitsresistenz gegen Pilze und Bakterien. In: Schütte, G., Stirn, S., Beusmann, V. (eds.). Transgene Nutzpflanzen: Sicherheitsforschung, Risikoabschätzung und Nachgenehmigungs-Monitoring, Birkhäuser, Basel, 154–174. 91 Prakash, C. S. 1998. Regulatory Gene Confers Resistance to Multiple Diseases. ISB News Report, June 1998. http://www. isb.vt.edu/news/1998/news98.jun. html#jun9803 (accessible August 2005). 92 Tu, J., Ona, I., Zhang, Q., Mew, T. W., Khush, G. S., Datta, S. K. 1998. Transgenic rice variety ‘IR72’ with Xa21 is resistant to bacterial blight. Theoret. Appl. Genet. 97 (1/2): 31–36. 93 Tai, T. H., Dahlbeck, D., Clark, E. T., Gajiwala, P., Pasion, R., Whalen, M. C., Stall, R. E., Staskawicz, B. J. 1999. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato. Proc. Natl. Acad. Sci. USA 96 (24):14153–14158. 94 Tang, X., Xie, M., Kim, Y. J., Zhou, J., Klessig, D. F., Martin, G. B. 1999. Overexpression of Pto activates responses and confers broad resistance. Plant Cell 11 (1):15–29. 95 Tang, K., Sun, X., Hu, Q., Wu, A., Lin, C.H., Lin, H.-J., Twyman, R. M., Christou, P., Feng, T. 2001. Transgenic rice plants expressing the ferredoxin-like protein (AP1) from sweet pepper show enhanced resistance to Xanthom*onas oryzae pv. oryzae. Plant Sci. 160:1035–1042. 96 Molina, A., Garcia-Olmedo, F. 1997. Enhanced tolerance to bacterial pathogens caused by the transgenic expression of barley lipid transfer protein LPT2. Plant J. 12 (3):669–675. 97 Düring, K., Porsch, P., Fladung, M., Lörz, H. 1993. Transgenic potato plants resis-

tant to the phytopathogenic bacterium Erwinia carotovora. Plant J. 3(4):587–598. 98 Nakajima, H., Muranaka, T., Ishige, F., Akutsu, K., Oeda, K. 1997. Fungal and bacterial disease resistance in transgenic plants expressing human lysozyme. Plant Cell Rep. 16:674–679. 99 Wu, G., Shortt, B. J., Lawrence, E. B., Fitzsimmons, K. C., Shah, D. M. 1995. Disease resistance conferred by expression of a gene encoding H2O2-generating glucose oxidase in transgenic potato plants. Plant Cell 7:1357–1368. 100 Norelli, J. L., Aldwinckle, H. S., Destéfano-Beltrán, A., Jaynes, J. M. 1994. Transgenic ‘Malling 26’ apple expressing the attacin E gene has increased resistance to Erwinia amylovora. Euphytica 77:123–128. 101 Reynoird, J. P., Mourges, F., Norelli, J., Aldwinckle, H. S., Brisset, M. N., Chevreau, E. 1999. First evidence for improved resistance to fire blight in transgenic pear expressing the attacin E gene from Hyalophora crecropia. Plant Sci. 149:23–31. 102 Osusky, M., Zhou, G., Osuska, L., Hanco*ck, R. E., Kay, W. W., Misra, S. 2000. Transgenic plants expressing cationic peptide chimeras exhibit broad-spectrum resistance to phytopathogens. Nature Biotechnol. 18:1162–1166. 103 Urwin, P.E., Troth, K.M., Zubko, E.I., Atkinson, H.J. 2001. Effective transgenic resistance to Globodera pallida in potato field trials. Mol Breed. 8:95–101. 104 Urwin, P.E., Green, J., Atkinson, H.J. 2003. Expression of a plant cystatin confers partial resistance to Globodera, full resistance is achieved by pyramiding a cystatin with natural resistance. Mol Breed. 12:263–269. 105 Atkinson, H. J., Urwin, P. E., Hansen, E., McPherson, M. J. 1995. Designs for engineered resistance to root-parasitic nematodes. Trends Biotechnol. 13:369–374. 106 Bajaj, S., Targolli, J., Liu, L.-F., Ho, T.-H., Wu, R. 1999. Transgenic approaches to increase dehydration-stress tolerance in plants. Mol Breeding 5:493–503. 107 Sakamoto, A., Alia, Murata, N. 1998. Metabolic engineering of rice leading to biosynthesis of glycinebetaine and tolerance to salt and cold. Plant Mol. Biol. 38:1011–1019.

2 Genetically Modified Plants 108 Zhu, B., Su, J., Chang, M. C., Verma, D. P. S., Fan, Y. L., Wu, R. 1998. Overexpression of a Δ1-pyrroline-5-carboxylate synthetase gene and analysis of tolerance to water- and salt-stress in transgenic rice. Plant Sci. 139:41–48. 109 Capell, T., Escobar, C., Liu, H., Burtin, D., Lepri, O., Christou, P. 1998. Overexpression of the oat arginine decarboxylase cDNA in transgenic rice (Oryza sativa) affects normal development patterns in vitro and results in putrescine accumulation in transgenic plants. Theoret. Appl. Genet. 97:246–254. 110 Roy, M., Wu, R. 2001. Arginine decarboxylase transgene expression and analysis of environmental stress tolerance in transgenic rice. Plant Sci. 160:869–875. 111 Capell, T., Bassie, L., Christou,P. 2004. Modulation of the polyamine biosynthetic pathway in transgenic rice confers tolerance to drought stress. PNAS 101:9909– 9914. 112 Xu, D., Duan, X., Wang, B., Hong, B., Ho, T. H. D., Wu, R. 1996. Expression of a late embryogenesis abundant protein gene, HVA1, from barley confers tolerance to water deficit and salt stress in transgenic rice. Plant Physiol. 110:249–257. 113 McKersie, B. D., Bowley, S. R., Jones, K. S. 1999. Winter survival of transgenic alfalfa overexpressing superoxide dismutase. Plant Physiol. 119:839–847. 114 Kasuga, M., Liu, Q., Yamaguchi-Shinozaki, K., Shinozaki, K. 1999. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nature Biotechnol. 17:287–291. 115 CIMMYT 2004. Results of transgenic wheat trial look promising. CIMMYT´s Electronic News, September 2004. http://www.cimmyt.org/english/wps/enews/index?mo=9&year=2004 (accessible August 2005) 116 Lee, J. H., van Montague, M., Verbruggen, N. 1999. A highly conserved kinase is an essential component for stress tolerance in yeast and plant cells. Proc. Natl. Acad. Sci. USA 96:5873–5877. 117 Zhang, H.-X., Blumwald, E. 2001. Transgenic salt-tolerant tomato plants accumulate salt in the foliage but not in fruit. Nature Biotechnol. 19:765–768.

118 Gisbert, C., Rus, A. M., Bolarin, C., Lopez-Coronado, J. M., Arrilaga, I., Montesinos, C., Caro, M., Serrano, R., Moreno, V. 2000. The yeast HAL1 gene improves salt tolerance of transgenic tomato. Plant Physiol. 123:393–402. 119 Takahashi, M., Nakanishi, H., Kawasaki, S., Nishizawa, N. K., Mori, S. 2001. Enhanced tolerance of rice to low iron availability in alkaline soils using barley nicotianamine aminotransferase genes. Nature Biotechnol. 19:466–469. 120 Guerinot, M. L. 2001. Improving rice yields – ironing out the details. Nature Biotechnol. 19:417–418. 121 de la Fuente, J.M., Ramirez-Rodriguez,V., Cabrera-Ponce, J.L., Herrera-Estrella, L. 1997. Aluminum tolerance intransgenic plants by alteration of citrate synthesis. Science 276:1566–1568. 122 Anoop, V.M., Basu, U., McCammon, M.T., McAlister-Henn, L., Taylor, G.J. 2003. Modulation of citrate metabolism alters aluminium tolerance in yeast and transgenic canola overexpressing a mitochondrial citrate synthase. Plant Physiology 132:2205–2217. 123 Delhaize,E., Ryan, P.R., Hebb, D.M., Yamamoto, Y., Sasaki, T., Matsumoto, H. 2004. Engineering high-level aluminium tolerance in barley with the ALMT1 gene. PNAS 101:15249–15254. 124 Farré, E. M., Bachmann, A., Willmitzer, L., Trethewey, R. N. 2001. Acceleration of potato tuber sprouting by the expression of a bacterial pyrophosphatase. Nature Biotechnol. 19:268–272. 125 Pena, L., Martin-Trillo, M., Juarez, J., Pina, J. A., Navarro, L., Martinez-Zapater, J. M. 2001. Constitutive expression of Arabidopsis LEAFY or APETALA1 genes in citrus reduces their generation time. Nature Biotechnol. 19:263–267. 126 He, Z., Zhu, Q., Dabi, T., Li, D., Weigel, D., Lamb, C. 2000. Transformation of rice with the Arabidopsis floral regulator LEAFY causes early heading. Transgenic Res. 9:223–227. 127 Ye, X., Al-Babili, S., Klöti, A., Zhang, J., Lucca, P., Beyer, P., Potrykus, I. 2000. Engineering the provitamin A (β-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science 287:303–305.

References 128 Potrykus, I. 2001. Golden Rice and Beyond. Plant Physiol. 125:1157–1161. 129 Römer, S., Fraser, P. D., Kiano, J. W., Shipton, C. A., Misawa, N., Schuch, W., Bramley, P. M. 2000. Elevation of the provitamin A content of transgenic tomato plants. Nature Biotechnol. 18:666–669. 130 Chen, Z., Young, T.E., Ling, J., Chang, S.-C., Gallie, D.R. 2003. Increasing vitamin C content of plants through enhanced ascorbate recycling. PNAS 100:3525–3530. 131 Abbadi, A., Domergue, F., Bauer, J., Napier, J.A., Welti, R., Zähringer, U., Cirpus, P., Heinz, E. 2004. Biosynthesis of Very-Long-Chain Polyunsaturated Fatty Acids in Transgenic Oilseeds: Constraints on their Accumulation. The Plant Cell 16:2734–2748. 132 Goto, F., Yoshihara, T., Shigemoto, N., Toki, S., Takaiwa, F. 1999. Iron fortification of rice seeds by the soybean ferritin gene. Nature Biotechnol. 17:282–286. 133 Lucca, P., Wünn, J., Hurrell, R. F., Potrykus, I. 2000. Development of iron-rich rice and improvement of its absorption in humans by genetic engineering. J. Plant Nutr. 23 (11/12):1983–1988. 134 Lucca, P., Hurrell, R., Potrykus, I. 2001. Genetic engineering approaches to improve the bioavailability and the level of iron in rice grains. Theoret. Appl. Genet. 102:392–397. 135 Chakraborty, S., Chakraborty, N., Datta, A. 2000. Increased nutritive value of transgenic potato by expressing a nonallergenic seed albumin gene from Amaranthus hypochondriacus. Proc. Natl. Acad. Sci. USA 97 (7):3724–3729. 136 Pratt, T. 1999. The quest for nontoxic cassava. ISB News Report, January 1999. http://www.isb.vt.edu/articles/jan9902. htm (accessible August 2005). 137 Sayre, R. T. 2000. Cyanogen reduction in transgenic cassava. Generation of safer food product for subsistence farmers. ISB News Report, August 2000. http://www. isb.vt.edu/articles/aug0003.htm (accessible August 2005). 138 Siritunga, D., Sayre, R.T. 2003. Generation of cyanogen-free transgenic casssava. Planta 217:367–373. 139 Sevenier, R., Hall, R. D., van der Meer, I., Hakkert, H. J. C., van Tunen, A. J.,

Koops, A. J. 1998. High level fructan accumulation in a transgenic sugar beet. Nature Biotechnol. 16: 843–846. 140 Rotino, G. L., Perri, E., Zottini, M., Sommer, H., Spena, A. 1997. Genetic engineering of parthenocarpic plants. Nature Biotechnol. 15:1398–1401. 141 Tomes, D. T. 1997. Seedless hopes bode well for winter vegetables. Nature Biotechnol. 15:1344–1345. 142 Barro, F., Rooke, L., Békés, F., Gras, P., Tatham, A. S., Fido, R., Lazzeri, P., Shewry, P. R., Barcelo, P. 1997. Transformation of wheat with high molecular weight subunit genes results in improved functional properties. Nature Biotechnol. 15:1295–1299. 143 Westwood, J. 1997. Transgenic bread is on the rise. ISB News Report, December 1997. http//:www.isb.vt.edu/articles/ dec9704.htm (accessible August 2005). 144 He, G. Y., Rooke, L., Steele, S., Békés, F., Gras, P., Tatham, A. S., Fido, R., Barcelo, P., Shewry, P. R., Lazzeri, P. A. 1999. Transformation of pasta wheat (Triticum turgidum L. var. durum) with high molecular weight glutenin subunit genes and modification of dough functionality. Mol. Breeding 5(4): 377–386. 145 McElroy, D., Jacobsen, J. 1995. What’s brewing in barley biotechnology? Bio/ Technology 13:245–249. 146 Nuutila, A. M., Ritala, A., Skadsen, R. W., Mannonen, L., Kaupinnen, V. 1999. Expression of fungal thermotolerant endo1,4-beta-glucanase in transgenic barley seeds during germination. Plant Mol. Biol. 41 (6):777–783. 147 Cho, M.-J., Wong, J. H., Marx, C., Jiang, W., Lemaux, P. G., Buchanan, B. B. 1999. Overexpression of thioredoxin h leads to enhanced activity of starch debranching enzyme (pullulanase) in barley grain. Proc. Natl. Acad. Sci. USA 96 (25):14641– 14646. 148 Pew Initiative on Food and Biotechnology 2001. Harvest on the horizon: future uses of agricultural biotechnology. http:// pewagbiotech.org/research/harvest/harvest.pdf. (accessible August 2005). 149 Arakawa, T., Chong, D. K. X., Langridge, W. H. R. 1998. Efficacy of a food plantbased oral cholera toxin B subunit vaccine. Nature Biotechnol. 16:292–297.

2 Genetically Modified Plants 150 Richter, L., Kipp, P. B. 2000. Transgenic plants as edible vaccines. In: Hammond, J., McGarvey, P., Yusibov, V. (eds.), Plant Biotechnology: New Products and Applications, Springer, Berlin, New York, 159–176. 151 Mason, H. S., Lam, D. M. K., Arntzen, C. J. 1992. Expression of hepatitis B surface antigen in transgenic plants. Proc. Natl. Acad. Sci. USA 89:11745–11749. 152 Thanavala, Y., Yang, Y.-V., Lyons, P., Mason, H. S., Arntzen, C. J. 1995. Immunogenicity of transgenic plant-derived hepatitis B surface antigen. Proc. Natl. Acad. Sci. USA 92:3358–3361. 153 Langridge, W. H. R. 2000. Edible vaccines. Sci. Am. 283 (3):66–71. 154 Tacket, C. O., Mason, H. S., Losonsk, G., Clements, J. D., Levine, M. M., Arntzen, C. J. 1998. Immunogenicity in humans of a recombinant bacterial antigen delivered in a transgenic potato. Nature Med. 4:607–609. 155 Goldstein, D.A., Thomas, J.A. 2004. Biopharmaceuticals derived from genetically modified plants. Q J Med 97:705–716. 156 Ma, J.K.-C., Drake, P.M.W., Christou, P. 2003. The production of recombinant pharmaceutical proteins in plants. Nature Reviews Genetics 4:794–805.

157 Cramer, C. L., Boothe, J. G., Oishi, K. K. 2000. Transgenic plants for therapeutic proteins: Linking upstream and downstream strategies. In: Hammond, J., McGarvey, P., Yusibov, V. (eds.), Plant Biotechnology: New Products and applications, Springer, Berlin, New York, pp. 95–118. 158 Fischer, R., Drossard, J., Commandeur, U., Schillberg, S., Emans, N. 1999. Towards molecular farming in the future: moving from diagnostic protein and antibody production in microbes to plants. Biotechnol. Appl. Biochem. 30:101–108. 159 Stöger, E., Vaquero, C., Torres, E., Sack, M., Nicholson, L., Drossard, J., Williams, S., Keen, D., Perrin, Y., Christou, P., Fischer, R. 2000. Cereal crops as viable production and storage systems for pharmaceutical scFv antibodies. Plant Mol. Biol. 42:583–590. 160 Parmenter, D. L., Boothe, J. G., Van Rooijen, G. J. H., Yeung, E. C., Moloney, M. M. 1995. Production of biological active hirudin in plant seeds using oleosin partitioning. Plant Mol. Biol. 29:1167–1180. 161 Komarnytsky, S., Borisjuk, N. V., Borisjuk, L. G., Alam, M. Z., Raskin, I. 2000. Production of recombinant proteins in tobacco guttation fluid. Plant Physiol. 124:927–933.

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi Rena Leisegang, Elke Nevoigt, Anja Spielvogel, Georg Kristan, Anke Niederhaus, and Ulf Stahl

3.1 Introduction 3.1.1 Why do we Ferment Foodstuffs?

Mankind has been fermenting foodstuffs such as bread, cheese, and wine for thousands of years. For example the brewing of beer or the making of bread evolved in ancient Babylon approximately 8,000 years ago [1]. Fermentation is the process of bioconversion of organic substances by microorganisms and/or enzymes. It is one of the oldest and most globally applied forms of preservation of a range of raw agricultural materials (cereals, roots, tubers, fruit and vegetables, milk, meat, fish etc.). The fermentation process can, first and foremost, be seen as a means of conserving food and protecting it against spoilage. The use of ethanol or acids obtained by fermentation hinders unwanted microorganisms and results in a product, for example beer, wine, and vinegar, which is more-or-less preserved. Beyond preservation, fermentation has been used to develop novel foodstuffs. There has always been a need to render raw materials more nutritious, to create something more palatable out of raw foodstuffs, making them more easy to digest, and, of course, to improve taste [2]. Our demands of food have not changed much with time. The ability of microorganisms to break down undigestable polymers by means of amylolytic or proteolytic enzymes contributes to the palatability of the product. Other metabolic activity can reduce levels of toxins in raw foodstuffs or produce vitamins and essential amino and fatty acids, thus increasing nutritional value. These actions also contribute to: 1. the flavor and texture of the food, by excreting metabolites such as aldehydes, acids, esters, ketones and sulfur compounds; and 2. the content of reductones, antioxidants, and antimicrobial compounds.

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

3.1.2 Fermented Foods of Plant and Animal Origin

This section provides a short overview on fermented foods which are produced using yeast or filamentous fungi. These are also categorized according to the type of raw material (plant or animal origin) involved. These listings (Table 3.1) are, naturally, far from complete.

Tab. 3.1 Fermented food of plant origin. Raw material

Product and/or process

Predominant yeast or fungus (bacteria)

Refs.

Barley

Beer

Saccharomyces cerevisiae

Barley, wheat

Lambic beer

Brettanomyces lambicus/ B. bruexellensis

Sorghum

Pito

Saccharomyces cerevisiae

Cereals

Bread

Saccharomyces cerevisiae

Rice

Sake

Saccharomyces cerevisiae Aspergillus oryzae

7, 8

Maize

Sour maize gruel

Saccharomyces cerevisiae (Lactobacillus confusus) Candida krusei

9, 10

Sugar cane

Cachaca (Aguardente)

Saccharomyces cerevisiae

11, 12

Grape

Wine

Saccharomyces cerevisiae

Grape

Champagne

Saccharomyces bayanus

Millet

Pombe (beer)

Schizosaccharomyces pombe

Palm juice

Ogogoro (gin)

Schizosaccharomyces pombe

Tea extract

Kombucha

Brettanomyces bruxellensis Candida stellata Schizosaccharomyces pombe Torulaspora delbrueckii Zygosaccharomyces bailii

15, 16

Olives

Olive fermentation

Pichia anomala Saccharomyces spp. Candida spp. Debaromyces spp. Geotrichum candidum

17, 18

3.1 Introduction Tab. 3.1 (continued) Raw material

Product and/or process

Predominant yeast or fungus (bacteria)

Refs.

Soy bean, wheat

Shoyu (Soy sauce)

Aspergillus spp. (Koji) Zygosaccharomyces rouxii (Moromi)

2, 8, 19

Soy bean, rice

Miso

Aspergillus oryzae Zygosaccharomyces rouxii

2, 20

Soy bean, peanuts, coconut

Tempe

Rhizopus spp.

Soy bean (milk)

Sufu (Tofu)

Rhizopus spp. Mucor spp. Aspergillus spp.

Peanut

Oncom

Rhizopus oligosporus Neurospora sitophila

In general, the microorganisms used to produce foodstuffs must fulfill certain criteria [2]: 1. the absence of toxinogenic and pathogenic potential; 2. competitiveness; 3. mycelia (for fungi) of white, yellowish, and ivory color; and 4. proteolytic and lipolytic activity for aroma formation. Fermentation of plants by yeasts results, for instance, in different, widespread, alcoholic beverages for example beer, wine, and sake and in a variety of traditional beverages, for example Cachaca and Ogogoro. Fermentation of raw foodstuffs of animal origin results in products such as cheese and meat. Examples of mold-ripened cheese are blue-veined cheeses such as Roquefort (France), Gorgonzola (Italy), and Stilton (UK). Roquefort is only made from sheep’s milk, whereas Gorgonzola and Stilton are produced from cows’ milk. All blue cheese are made with Penicillium roqueforti which grows inside the product. Examples of mold-ripened soft cheeses with Penicillium camemberti growing on the surface are Camembert and Brie [2]. Other cheeses, for example Limburger, Tilsiter, Port Salut, Trappist, Brick, and Danish Danbo are also surface-ripened cheese. The use of yeast is predominant during the initial period of ripening, in which it is used to increase the pH on the cheese surface, thereby enabling growth of bacteria present in the smear. Strains of Debaryomyces hansenii (among Kloeckera and Trichosporon species) in particular are supposed to be responsible for the increase of pH by degrading lactic acid [21]. The yeast Klyveromyces lactis is also used for cheese ripening [22]. Naturally fermented sausages produced in Italy are examples of fermentation of meat by a combination of different microorganisms. Several Lactobacillus and

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

Staphylococcus bacteria species and the yeast genera Candida, Debaromyces, and Willopsis are involved in the preservation of meat products [23]. Nontoxic Penicillium species, for example Penicillium nalgiovense, are used as a starter culture for cured and fermented meat to prevent the surface growth of mycotoxic molds such as Aspergillus. Other meat products include mold-ripened hams, for example “Bündnerfleisch” from Switzerland, “Südtiroler Bauernspeck” from Tirol, and Italian “coppa” [2]. A mixed culture consisting of a variety of species of the genera Kluyveromyces, Candida, Pichia, and Saccharomyces and some lactic acid bacteria can be used to produce Kefir by fermenting milk whey or fruit juice [24].

3.2 Yeast

This section deals with the use of molecular genetics for optimizing yeast strains relevant in the production of fermented foods. The emphasis here is on enhancement of metabolism in respect to faster fermentation, changes to optimize particular fermentation features relevant to the production process (e.g. flocculation), extension of yeast’s substrate spectrum, and alteration of byproduct formation. Genes referred to in the text are summarized in Table 3.2. 3.2.1 Methods of Recombinant DNA Technology in Yeast

Saccharomyces cerevisiae is by far the most analyzed yeast strain as regards genetics, physiology, and biochemistry. In fact, bakers’ yeast was the first eukaryotic organism to be genetically transformed [25], and its genome has been fully sequenced [26]. Many databases are now available on the Web, for example the Saccharomyces Genome Database (SGD, http://www.yeastgenome.org/), the Munich Information Center for Protein Sequences (MIPS, http://mips.gsf.de/genre/proj/ yeast/), the Yeast Proteome Database (YPD, http://www.proteome.com/), and the European Saccharomyces cerevisiae Archive for Functional Analysis (EUROSCARF, http://web.uni-frankfurt.de/fb15/mikro/euroscarf/) etc., which contain an enormous amount of information about each open reading frame of this organism. As Saccharomyces species are the yeasts most used for fermentation of foodstuffs (Table 3.1), we first focus on recombinant techniques in S. cerevisiae (other reviews are available elsewhere [14, 25, 27–32]. We also provide more information later in the section on non-Saccharomyces yeasts (again, reviews are available elsewhere [33, 34]). The first procedure on molecular transformation in S. cerevisiae, which involves the production of protoplasts by means of enzymes such as glucuronidase or zymolyase, was described in 1978 [25]. Protoplasts were incubated in the presence of transforming DNA and polyethylene glycol (PEG) and then spread on selective media. One of the main disadvantages of this “spheroplast method” is that PEG stimulates cell fusion, because of incomplete removal of the cell wall [35], which

3.2 Yeast Tab. 3.2 Genes relevant to genetic modification of yeasts. Gene

Organism

Function

ADE1

S. cerevisiae

ALD6 ALD7 ATF1 FAS2 FLO1 FLO5 FLO8 FLO11 GOX1 GPD1 HAP4 HIS3 his5+ HSP30 HXT ILV5 LEU2 MAL MEL1 MET2 MET3 MET10 MET14 MET25 MIG1 MIG2 PGK1 PGU1 rhaA STA2 SSU1 TRP1 URA3

S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae Aspergillus niger S. cerevisiae S. cerevisiae S. cerevisiae S. pombe S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae S. cerevisiae A. aculeatus S. diastaticus s. cerevisiae S. cerevisiae S. cerevisiae

Phosphoribosyl amino imidazolesuccinocarbozamide synthetase Aldehyde dehydrogenase Aldehyde dehydrogenase Alcohol acetyltransferase Fatty acid synthase Cell wall protein, mannose binding Cell wall protein, mannose binding RNA polymerase II transcription factor Cekk surface protein Glucose oxidase Glycerol 3-phosphate dehydrogenase Transcription factor Dehydratase in histidine biosynthesis complements S. cerevisiae his3 mutation Heat-shock-protein 30 Permease gene family Acetohydroxyacid reductoisomerase Dehydrogenase in leucine biosynthesis Maltose permease gene family Melibiase hom*oserine acetyltransferase Sulfate adenyltransferase Sulfite-reductase Adenyl-sulfatekinase Acetyl hom*oserine-(thiol)-lyase Transcription co-repressor Transcription co-repressor Phosphoglyceratkinase Endopolygalacturonase α-I-rhamnosidase Glucoamylase Plasma membrane sulfite pump Phosphoribosylanthranilate isomerase Dexarboxylase

may result in diploids and polyploids [36]. An alternative procedure used to transform yeast is referred to as the lithium acetate method. Whole cells are treated with lithium salts then PEG is added [37]. The successful uptake of DNA by whole cells using PEG alone was demonstrated in the same year [38], but transformation was only one third as efficient as treatment with additional lithium acetate [39]. It has also been demonstrated that the efficiency of transformation varied for different strains and methods [28], thus emphasizing that strain and method of transformation have to be carefully selected. Yeasts can also be transformed by electro-

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

poration. Electric pulses are applied both to yeast spheroplasts [40] and to intact yeast cells, including PEG in the electroporation buffer [41]. Other variations of the procedure used for pretreatment of the yeast cells in the early phase of exponential growth are treatment with dithiothreitol [42], sorbitol [43] or HEPES buffer [44]. A hybrid technique using elements of both the LiAc/PEG and electroporation procedures has also been reported [45]. Other methods used for transformation of yeast cells are agitation with glass beads in the presence of DNA [46] or the biolistic approach, first developed for plant cells [47] and then successfully transferred to yeast cells [48]. Lithium acetate and electroporation are currently the methods of choice [49–52]. All genetic engineering approaches require at least one selectable genetic marker to successfully identify transformed cells. There are two general types of selection marker for yeasts: 1. genes complementing an auxotrophy of the yeast strain used; and 2. genes conferring resistance against antibiotics or other toxic agents. The latter are referred as to dominant markers. The first type of genetic marker can only be used in yeast strains carrying mutations conferring auxotrophy, i.e. use is virtually limited to haploid laboratory yeasts. For example, mutants defective in one of the genes encoding enzymes involved in biosynthesis of amino acids (leu2, trp1, his1) or nucleic bases (ade1, ura3) are often used [53]. These mutations, i.e. the phenotypic defects enabling growth on minimal medium without respective nutrients, can be complemented after transforming the mutants with the corresponding wild-type genes (LEU2, TRP1, HIS1, ADE1 and URA3). It is important to know that yeast strains which only contain a simple point mutation in the auxotrophic marker gene can change to the wild-type phenotype without transformation, but only by reverse mutation and with very low efficiency. Hence, it is much better to work with auxotrophic strains which have either a gene deletion or more than two point mutations in the gene of interest. Ideally, the genetic marker enables efficient selection without affecting cellular functions. In this context, the reader is referred to the review by Pronk [54], which covers several important aspects relevant to the application of yeast strains bearing auxotrophies and the complementing marker genes. For integrative approaches (see below), it is important that the genetic marker used has no sequence hom*ology with the wild-type genome, to reduce the frequency of integration at nontargeted loci. For this reason heterologous marker genes which complement auxotrophies in S. cerevisiae, for example URA3 and LEU2 from Kluyveromyces lactis and his5+ from Schizosaccharmomyces pombe, are often used [55]. Markers complementing auxotrophies are less suitable for these purposes, because industrial strains are often diploid or even polyploid and, hence, auxotrophic mutant strains are rarely available. In such circ*mstances dominant markers are an excellent alternative (see above). The most widely used dominant marker is resistant to Geneticin 418 (geneticin is a derivative of kanamycin). The bacterial kanamycin-resistance gene of Tn309 can confer resistance to geneticin in yeast [56].

3.2 Yeast

When fused to a yeast promoter it can even be used as a selectable marker in single-copy transformants of yeast. Many alternative dominant markers are available. In addition to those listed by Akada [32] genes conferring resistance to hygromycin B [57], neomycin [58], nourseothricin, and bialaphos [59] have also been tested for their utility in yeast. There are two methods by which transformed DNA can be established in yeast cells: 1. as an autonomously replicated molecule; or 2. integrated into one of the yeast chromosomes enabling stable inheritance without selection pressure. Vectors used for yeast transformation therefore fall into two classes – those which are maintained as an episomal plasmid which replicates autonomously i.e. yeast episomal plasmids (YEp) and yeast centromeric plasmids (YCp), and those which are integrated into the host’s genome while being passively inherited, i.e. yeast integrative plasmids (YIp) [29]. Yeast integrative plasmids are becoming increasingly obsolete because of the ease of one-step gene integration methods using integration cassettes simply created by PCR (see below). Yeast vectors are E. coli-yeast shuttle vectors and contain a backbone of an E. coli vector mainly derived from pBR322 or pUC, including an origin and a selection marker for E. coli (mainly genes encoding enzymes which confer resistance to antibiotics). This is usually necessary to clone and propagate the plasmids in E. coli. There is, however, an elegant strategy which can partly circumvent time-consuming cloning steps in E. coli. This method which relies on hom*ologous recombination in yeast has been referred to as recombinational cloning [60]. Two types of yeast sequence are mainly used as origins in yeast self-replicating vectors: 1. a fragment of the 2-μm plasmid in yeast; and 2. autonomous replicating sequences (ARS). The 2-μm plasmids are naturally occurring plasmids (circular and doublestranded DNA) in S. cerevisiae. There are approximately 50–100 copies per cell. The biological function of these plasmids are unknown. They confer no obvious advantage on the cells. They can, however, replicate themselves, and contain an origin and so-called “partitioning elements” which are responsible for equal partitioning during cell division. The first 2-μm plasmid-derived yeast vectors contained the whole 2 μm plasmid combined with pBR322 for replication in E. coli, plus the LEU2 gene for selection [61]. Later, smaller vectors were designed containing, for example, only the ORI-STB region as the minimum portion [29] circumventing the recombination with the endogenous 2-μm plasmid of yeast observed earlier. Vectors derived from 2-μm plasmids have high transformation efficiency and a high copy number (10–40 per cell). They are, however, less stable than integrative vectors and get lost during growth without selective pressure. The second type of self-replicating vector contains an ARS sequence. These plasmids are usually very unstable. Cloning centromeric sequences (CEN) in ARSbased plasmids yields centromeric plasmids (YCp). These vectors behave like chro-

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

mosomes, i.e. there are one or two copies per cell and they are very stable even under nonselective conditions. Yeast integrative vectors do not contain an origin of replication for yeast. Those vectors can only be stably inherited by yeast if integrated into one of the yeast chromosomes after transformation. Integration relies on the mechanism of hom*ologous recombination, which is very effective in yeast. This process requires a sequence in the vector which is hom*ologous with yeast chromosomal DNA. The efficiency of this type of transformation is very low (usually about 100 to 1000-fold lower than for use of self-replicating vectors) and is highly dependent on the length of hom*ologous sequence used. The frequency of transformation events can be improved by linearizing the vector DNA using a restriction enzyme within the region which is hom*ologous with the target site at the chromosome [62]. After transformation and hom*ologous recombination, an integrative vector is mainly present in one copy and mitotically stable. Target sites for integration should be carefully chosen to prevent or minimize negative effects on yeast physiology. If desired, the copy number of integrated DNA can be increased by choosing repeating target sequences within the genome, for example ribosomal DNA [63, 64] or the delta sequences of the yeast retrotransposon Ty1 [65, 66]. Nowadays, integration of DNA sequences or disruption of genes by gene replacement is mainly performed using linear PCR fragments instead of YIp-based vectors. The PCR-generated integration cassettes contain a genetic marker and, if desired, an additional sequence, e.g. a gene of interest. The cassette must be flanked by sequences hom*ologous with the desired integration site, because integration is mediated by hom*ologous recombination (double crossover). As 30–45 bp of hom*ology are sufficient to promote hom*ologous recombination in yeast [67], the flanking sequences can simply be added by designing the PCR primers in the appropriate way. For commercial applications in food production and processing, yeast strains should be free from nonessential foreign DNA, especially genetic markers conferring resistance to antibiotics. For complete marker rescue, the marker genes can be surrounded by direct repeats. hom*ologous recombination between the two repeats results in marker removal, leaving behind a single repeat at the integration locus [68–70]. The frequency of mitotic recombination is very low, however, which makes the selection process very laborious. This selection process can be facilitated by counter-selection, e.g. use of growth conditions in which only those cells which have lost the marker can grow. A wide variety of counter-selection systems has been listed by Akada [32]. Alternatively, the Cre-loxP recombination system of bacteriophage P1 has been shown to mediate efficient recombination between loxP sites flanking a marker gene in yeast, resulting in excision of the marker [71] and leaving one loxP sequence in the yeast genome. A collection of variable genetic markers flanked by loxP-sequences has been provided [55, 72]. Storici et al. [73] developed a marker recycling system based on FLP-FRT recombinase from 2-μm plasmid. Amounts of genetic, biochemical, and physiological information and technology for non-Saccharomyces yeasts, for example Klyveromyces spp., Pichia spp., Hansenu-

3.2 Yeast

la spp., and Zygosaccharomyces spp., are, in general, much less than for S. cerevisiae, but growing constantly (reviews are available elsewhere [33, 34, 74]). Transformation systems for these so called nonconventional yeasts depend heavily on those developed for S. cerevisiae [75]. The most commonly used markers are derived from the biosynthetic pathway of the hom*ologous system, but those from S. cerevisiae are also found to be effective [76–78]. Endogenous plasmids have been isolated and characterized for Yarrowia lipolytica, K. lactis, Z. rouxxii, and Z. baili [34]. Autonomous replication may also be based on ARS-like sequences, e.g. the PARS sequences for Pichia pastoris [79], or HARS sequences for Hansenula polymorpha [80]. Alternatively, integrative approaches have been used. Targeted integration or gene disruption can be performed for many types of yeast, as described for S. cerevisiae [81–84]. For example, two integrating vectors developed for use in S. cerevisiae were successfully used for cloned gene integration in K. lactis [85].

3.2.2 Genetically Modified Saccharomyces Strains

Until the 1970s, strain development resulted mainly from work on selection, mutation, and classical breeding. During the last few years methods of strain improvement have changed radically from these classical attempts to more rational approaches, for example genetic engineering. This involves introduction of directed genetic changes into the cell by recombinant DNA technology. In 1991 Bailey defined this approach as “metabolic engineering”; this is simply the “technological manifestation of applied molecular biology”. Since this initial definition of metabolic engineering this term has broadened its meaning and now covers a variety of different aspects of molecular biology, for example heterologous protein production, extension of substrate range, introducing pathways leading to novel products or to degradation of xenobiotics, elimination or reduction of byproduct formation, engineering of cellular physiology for process improvement, and improvement of yield or productivity [86]. In the following text we describe different approaches for improving industrial strains by means of metabolic engineering. Species of the genus Saccharomyces are used for biologically processed food products, for example bread, spirits, wine, and beer. The exploitation of non-Saccharomyces yeast and filamentous fungi for production of food will be discussed later. To modify biochemical pathways in industrial yeasts, one needs extensive knowledge of their genetic structure. The most detailed studies were performed for a lager brewers’ yeast strain called Saccharomyces carlsbergensis, which was isolated by E. C. Hansen in 1883 [87]. The lager brewing yeast (“bottom-fermenting”) is currently classified as S. pastorianus [88] and is thought to be a natural hybrid between S. cerevisiae and another unknown Saccharomyces species [89] which is closely related to S. monacensis [90, 91] or to S. bayanus [92, 93]. Ale yeasts (“top-fermenting”) are a diverse group of polyploid yeasts. These are not, in contrast with lager-brewing yeasts, genetic hybrids and are, therefore, more genetically related to laboratory strains of S. cerevisiae.

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

Most wine yeasts are isolates of S. cerevisiae or S. bayanus [94, 95]. S. bayanus seems to contain a genome which originates from both S. cerevisiae and S. monacensis [90, 96].

3.2.2.1 Beer Beer is produced from malted barley or other cereals, hops, and water, according to the German “Reinheitsgebot” of 1516 (purity regulations for beer brewing). It was not until 1680, however, that the microscope was developed and brewers’ yeast was identified. In addition to improving the brewing process by technological means, in the last 20 years much effort has been devoted to genetic modification of brewers’ yeast. The genetically modified strains which have been developed can ferment a wider range of carbohydrates, have altered flocculation properties, and can produce beers with modified flavors (other reviews are available elsewhere [97–100]). Carbohydrate utilization Brewers’ yeast utilizes mono, di, and trihexoses only. To metabolize other oligomers (e.g. maltotriose dextrins or β-glucans) several attempts have been made to express glucoamylase and β-glucanase genes of different origin. Biodegradation of usually unfermented wort compounds leads to a low-carbohydrate beer. Elimination of β-glucans resulted in improved filterability and haze stability, thus providing an example of both extension of the substrate range and the improvement in the production process and the quality of the beer. Examples of, and references to, extension of the substrate range in industrial yeast strains are listed in Table 3.3.

Tab. 3.3 Extension of the range of substrates for industrial yeast strains (modified from Ref. [100]). Substrate extension

Achievements

Refs.

Starch and dextrins

Expression of α-amylase (AMY1) and glucoamylase (GAM1) genes of Schwanniomyces occidentalis[*,**]

101

β-Glucans

Integration of a β-glucanase gene of barley[*]

102

Malate

Expression of malate permease (MAE1) of Schizosaccharomyces pombe and malic enzyme of S. pombe (MAE2) or Lactococcus lactis (mleS)[***]

103

Melibiose

Introduction of melibiase gene (MEL1)[**]

104

* ** ***

Brewers’ yeast Bakers’ yeast Wine yeast

3.2 Yeast

Reduction of ethanol content To produce beer with a reduced alcohol content, the GPD1 gene encoding glycerol-3-phosphate dehydrogenase was overexpressed in a lager brewing yeast to increase glycerol production at the expense of ethanol formation. The amount of glycerol produced by the GPD1-overexpressing yeast was increased 5.6 times and ethanol was reduced by 18% compared with the wild-type. Concentrations of several byproducts, particularly acetoin, diacetyl, and acetaldehyde, also increased substantially, however [105]. Flocculation A suitable brewers’ yeast strain should be able to flocculate, leading to natural clearing of beer at the end of fermentation. Flocculation is a very complex process that depends on expression of a variety of specific genes, for example FLO1, FLO5, FLO8, and FLO11 [106]. Because flocculation throughout the fermentation process results in lower cell counts and increased fermentation time, regulated expression of the flocculation genes is crucial. For example, phase-specific expression of FLO1 was achieved by using the HSP30 promoter, inducing high gene expression during the late stationary phase [107]. Flavor Applications of genetic engineering to brewing yeast with the objective of optimization of beer flavor are, for example, elimination of unwanted byproducts, for example diacetyl and hydrogen sulfide, or the increased production of antioxidants such as sulfur dioxide. Diacetyl is a major off-flavor in beer resulting from overflow of the valine biosynthetic pathway. It is formed during fermentation by spontaneous oxidation of α-acetolactate, which diffuses from yeast cells into the fermenting wort. The expensive and time-consuming maturation of green beer is, to some extent, because of the slow conversion of diacetyl to acetoin and then to 2,3-butanediol; a metabolite with a much higher taste threshold than diacetyl. There are many ways of avoiding the extensive maturation time by reducing diacetyl formation (Ref. [97] and references cited therein). These methods imply introduction of the heterologous gene for α-acetolactate decarboxylase (ALDC), thus enabling the cell to produce acetoin directly from α-acetolactate and reducing the time of lagering from weeks to hours. Other attempts to minimize diacetyl formation involve the overexpression or deletion of genes encoding enzymes of the valine biosynthetic pathway to reduce the formation of α-acetolactate (a review is available elsewhere [87]). The construction of a strain of recombinant brewers’ yeast with reduced capacity to produce hydrogen sulfide has also been successful. This approach will also result in a shorter maturation time and reduced costs of lagering. A promising attempt by Omura et al. [108] was placing the MET25 gene of the sulfate metabolic pathway downstream of a constitutive glycolytic promoter. The expression cassette was integrated into the rDNA array of a brewers’ yeast strain. Flavor stability in the finished beer is maintained by sufficient levels of sulfur dioxide which acts both as an antioxidant and a complexing agent of carbonyl compounds responsible for stale flavors. Many strategies have been employed on a variety of genes of the sulfate metabolic pathway to alter sulfur dioxide levels. Increased sulfite production and excretion have been achieved by overexpression of

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

genes such as SSU1 and MET14 [109, 110]. The objectives of other strategies include disruption of the MET2 and MET10 genes, the latter being more successful than the former (Ref. [97] and references cited therein).

3.2.2.2 Wine Wine has been produced for thousands of years from grapes and their inhabitant microflora, provided either by the vineyard or the winery. The predominant yeast species responsible for the wine-making process are S. cerevisiae and subspecies such as S. bayanus (in the following text referred to as wine yeast) which convert grape sugars. The objectives of recombinant technology with wine yeast are improvement of fermentation performance, processing efficiency, and flavor characteristics. Several attempts have been carefully reviewed [95]. Fermentation performance To extend the range of carbon and nitrogen assimilation beyond catabolite repression, experiments have been conducted on the basis of the extensive knowledge of the genes involved in the glycolytic and nitrogen pathways [95, 100]. Efficient sugar utilization was the objective of overproducing all glycolytic enzymes, but ethanol formation could not be increased [111]. A different approach could be overexpression of genes of the HXT permease gene family which enable high-affinity glucose uptake [95]. Processing efficiency Refining and clarification at the end of wine processing comprises removal of excess amounts of some compounds. Because polysaccharides have a detrimental effect on clarification and stabilization of must and wine, both heterologous and endogenous genes have been overexpressed to enable enzymatic degradation of pectins, glucans, and hemicellulose (mainly xylans) [95]. Overexpression of an endogenous PGU1 gene coding for an endopolygalacturonase in an oenological S. cerevisiae strain recently led to significant reduction of filtration time in wine production [112]. Flavor Improvement of wine flavor and other sensory qualities entails enhancement of terpenoids of grape origin, volatile esters, and glycerol produced, and, last but not least, the adjustment of wine acidity. Terpenoids are secondary metabolites of grapes and desirable volatile compounds in wine. By heterologous expression of the β-1,4-glucanase gene of Trichoderma longibrachiatum in wine yeast, aroma intensity was presumably increased because of hydrolysis of glycosylated terpenoid precursors [113]. The expression of the rhaA gene, encoding an α-1-rhamnosidase from Aspergillus aculeatus, in combination with overexpression of β-D-glucosidase from Candida molischiana resulted in increased content of the aromatic compound linalool [114]. Esters have characteristically fruity odors and require acetyltransferase activity for their synthesis. Levels of esters formed during primary fermentation vary substantially. The ATF1-encoded alcohol acetyltransferase (AAT) is one of the beststudied in S. cerevisiae [106]. Integration of the ATF1 gene under the control of

3.2 Yeast

the constitutive PGK1-promoter in commercial wine yeast strains resulted in an improved flavor profile of the wine produced because of increased formation of desirable esters [115]. Glycerol, a nonvolatile compound, contributes to sensory characteristics such as the sweetness, smoothness, consistency, and overall body of the wine. Attempts have been made to overproduce glycerol to improve the wine’s organoleptic quality. This is especially useful for white wine, which contains smaller amounts of glycerol than red wine. It has been shown that both overexpression of GPD1 and disruption of ALD6 and ALD7 led to two to threefold greater glycerol production (at the expense of ethanol) and a significant decrease of acetate formation [116, 117]. The predominant organic acids in wine are tartaric and malic acid, which account for 90% of the titratable acidity of grapes. When these are not suitably adjusted, imbalance or even spoilage of the product can result. The ability of S. cerevisiae strains to assimilate malic acid varies widely, mainly because of the absence of an active malate transport system. In addition to S. cerevisiae’s inefficient metabolism of malate, substrate specificity of malic enzyme is low. It has been shown that integration of Schizosaccharomyces pombe genes encoding for malate permease (mae1) and malic enzyme (mae2) into the genome of S. cerevisiae resulted in efficient degradation of malic acid in Chardonnay grape must [118]. The sulfate reductase MET10 gene has been used to develop wine yeasts producing less hydrogen sulfide, to improve wine flavor [119]. Becker et al. recently developed a wine-yeast which produces resveratrol, a natural compound of red wine with antioxidant and antimutagenic properties [120].

3.2.2.3. Sake Sake is a typical Asian alcoholic beverage produced from rice by use of sake yeast (mainly S. cerevisiae) and Aspergillus oryzae. A few attempts have been made to genetically modify sake yeast strains to enhance flavor. Flavor To improve the flavor profile of sake, a self-cloning yeast that overexpressed ATF1 gene was constructed [121]; this led to an increase in the isoamyl acetate production. A greater amount of ethyl caproate, which is the apple-like flavor component, was achieved by point mutation of the yeast’s fatty acid synthase gene FAS2 [122].

3.2.2.4. Bread Bread is made by fermenting dough, mainly from wheat and other cereals, with bakers’ yeast and, for sourdough, Lactobacillus also. The requirements of a well performing bakers’ yeast are [6, 86, 98, 100]: 1. efficient respiratory metabolism during biomass production to enable an economic yield from raw substrates; and 2. formation of substantial quantities of carbon dioxide during dough production. Improvements to bakers’ yeast encompassed both requirements.

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

Fermentation in dough substrates The ability of bakers’ yeast to ferment depends on a high potential to utilize maltose, which results from hydrolysis of starch by endogenous amylases present in the dough. The presence of glucose prevents maltose from being absorbed by the cell and metabolized – a general regulatory mechanism widely known as catabolite repression. Glucose represses synthesis of maltase (MalS) and maltose-permease (MalT) and inactivates maltase enzyme (MalR), leading to a substantial lag in adaptation to the maltose. Strategies for metabolic engineering to diminish the extent of glucose control imply the constitutive expression of the MAL genes together with disruption of regulatory genes such as MIG1 and MIG2. This attempt could partly alleviate glucose control, and the specific growth rate was increased with both glucose and maltose, leading to shorter processing time for bread production [123, 124]. Biomass yield To increase biomass yield, bakers’ yeast strains able to utilize melibiose by expressing the MEL1 gene have been constructed by use of metabolic engineering [104]. Another promising strategy for expanding productivity is overexpression of the transcription factor Hap4p [125], which results in an improved growth rate with a 40% gain of biomass yield and a significant reduction of ethanol production. 3.2.3 Genetically Modified Non-Saccharomyces Strains

Nonconventional yeasts have particular advantages compared with S. cerevisiae, for example ability to grow on unusual carbon sources, better ability to cope with several types of stress, absence of the Crabtree-effect which results in high cell densities, lack of hyperglycosylation, or the availability of stringently regulated promoters for the expression of toxic proteins. Nonconventional yeasts are therefore becoming increasingly important for economic production of heterologous proteins [34]. Numerous non-Saccharomyces yeasts are involved in food production, however, e.g. Schizosaccharomyces (alcoholic beverages, Kombucha), Zygosaccharomyces (fermentation of soy bean), Candida (meat fermentation, wine production, Kefir production), Pichia (olive fermentation, meat fermentation, wine production), Klyveromyces (meat fermentation, cheese ripening) (Table 3.1). Few examples of genetic engineering of food-relevant non-Saccharomyces yeasts are known. The importance of S. pombe for production of traditionally fermented beverages, for example pombe and ogogoro, has already been discussed, but little is known about strain improvement either by the classical breeding approach or by genetic modification [28]. To remove gluconic acid from musts of rotten grapes glucose-transport-deficient Schizosaccharomyces pombe mutants were used and could remove 93% of gluconic acid and 80% of initial malic acid [126]. Zygosaccharomyces rouxii is an osmotolerant and halophilic yeast used to provide characteristic aromas to Japanese soy sauce and miso. Methionol (3-methylthio-1propanol) is a characteristic flavor compound of soy sauce. Strain improvement for production of soy sauce has been achieved by simple selection for mutants [127].

3.3 Filamentous Fungi

An L-methionine-resistant mutant strain was found to be partly deficient in conversion of methionine into S-adenosyl-methionine (SAM); this led to a sixtyfold increase in methionol production.

3.3 Filamentous Fungi

This section describes progress in biotechnology of filamentous fungi, the focus being on methods which can be used to improve products based on filamentous fungi and on applications of the amended fungi. Filamentous fungi are used not only for direct fermentation of foodstuffs (Section 3.1.1) but also to produce proteins used as additives in the food industry. As with yeast, the development of improved strains of filamentous fungi requires genetic engineering techniques to impart favorable and remove adverse properties.

3.3.1 Recombinant DNA Technology in Filamentous Fungi

Several filamentous fungi have been investigated at the genetic level. In particular, fundamental and applied aspects of the model filamentous fungi Aspergillus nidulans and Neurospora crassa have been studied in great detail. This has led to the development of fungal vectors and genetic engineering techniques. Subsequently, other Ascomycetes and Deuteromycetes of biotechnological interest have been successfully transformed. The first fungal transformation of N. crassa was performed more than 25 years ago [128]. Methods must, however, be adapted for every fungal class or even strain.

3.3.1.1 Strategies used to Transform Filamentous Fungi Protoplast transformation (Calcium/PEG) Transformation of protoplasts is the general method used to transform filamentous fungi. By use of this method protoplasts from mycelia, germinating conidia, or basidiospores are commonly prepared by use of lytic enzymes, for example Novozym 234, Glusulase, and Zymolyase [129–131]. All these enzyme preparations contain a mixture of cell-walldegrading enzymes, mainly glucanases and chitinases. Enzyme preparations differ between batches, however, and isolation of protoplast is very time-consuming. Traditionally, uptake of DNA is achieved via protoplasts exposed to calcium ions and polyethylene glycol (PEG).

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

Electroporation Electroporation has been widely used to transform animal cells, plant protoplasts, yeast, and bacteria [85, 132, 133]. Filamentous fungi can be transformed via electroporation either after cell-wall weaking [134], with protoplasts [135] or germinating conidia [136]. Systems for electroporation have been established for many filamentous fungi (e.g. N. crassa, A. oryzae [134], A. nidulans [136], and A. niger [137]). Biolistic transformation Whole mycelium can be transformed by use of a particle gun (shotgun or biolistic approach) where DNA-coated tungsten balls are shot into the mycelium [138]). The transformation methods mentioned above are described in detail in a recent review by Ruiz-Diez [139]. Agrobacterium tumefaciens-mediated transformation (ATM) The most recent approach used to obtain integrative transformants is the Agrobacterium tumefaciensbased method. Several fungi (Aspergillus spp. [140, 141], Basidiomycetes [141], Zygomycetes [142], and Oomycetes [143]) have been successfully transformed and the number of fungi is still increasing. Transformation can be achieved without the need for protoplast. Integration occurs at random [144], although efficient hom*ologous integration has also been reported [145]. A recent publication by Michielse et al. [146] summarizes the current state-of-the-art of using ATM in fungi.

3.3.1.2 Selection Systems A wide range of selection systems based on auxotrophic markers and drug-resistance markers is available for filamentous fungi. Here the complementing or resistance gene can be hom*ologous or heterologous, even when from a bacterial source [147]. One of the disadvantages of using auxotrophic markers is that appropriate mutant strains are required; these are difficult to obtain for species for which genetic engineering methods have not been established. For example, to utilize the pyrG [148] (orotidine-5-decarboxylase) and niaD [149] genes (nitrate reductase) as selectable markers, uracil auxotrophs and strains lacking nitrate reductase are necessary. The most common methods used to screen for these mutants use 5-fluoroorotic acid (5-FOA) and chlorate, respectively. The use of pyrG as a selectable marker has several advantages over other selection systems. It has been reported by Fierro et al. [150] that: 1. transformation rates using pyrG are much higher than with any other system; 2. hom*ologs have been isolated from a variety of fungi (P. nalgiovense, A. nidulans, N. crassa), thus hom*ologous selection markers can be used; this overcomes concerns about genetically engineered strains of microorganisms used in the food industry, because no heterologous genes are actually introduced into the production strain; in addition 3. pyrG enables counter-selection using 5-FOA, thus the selection marker can be eliminated and used for successive transformations of the same strain.

3.3 Filamentous Fungi

Another commonly used system is characterized by incorporation of the amdS gene of A. nidulans, coding for acetamidase [149]. Drug-resistance markers have the advantage that no detailed genetic information and mutants are necessary to perform a successful transformation. Resistance genes, e.g. to oligomycin or benomyl, encoded either by fungal genes or by bacterial genes (cloned together with a fungal promoter), for example phleomycin or hygromycin B are frequently used. Ruiz-Dìez [139] summarized the following disadvantages of using drug-resistance genes: 1. the allele for resistance must be isolated to transform wild-type strains; 2. the resistance gene may not show significant dominance, resulting in selection difficulties; 3. some species are relatively resistant to, e.g., hygromycin; and 4. compounds used for selection are often very expensive and result in selective media being expensive. Drug-resistance markers are, nevertheless, usually used.

3.3.1.3 The Fate of the Transforming DNA DNA that has been introduced into filamentous fungi will either be maintained autonomously (rarely) or integrated into the genome via hom*ologous or heterologous integration events. hom*ologous integration can target special loci in the genome, in which the integration cassette can integrate once or in tandem repeats, whereas heterologous recombination events can occur at undefined sites, resulting in single or multicopy integrations. hom*ologous integration can be achieved via a single cross-over event (leading, e.g., to a disruption of an undesired gene) or via a double cross-over event (leading to gene deletion). In general, this approach requires long hom*ologous flanking regions (1000 bp) and has to be optimized for every fungal strain. In a recent study, Yu et al. [151] used integration constructs with flanking regions ranging from 480 bp to 4.3 kb and observed an hom*ologous recombination (HR) frequency of 0–40%. hom*ologous integration is necessary to target a gene of interest to a locus which houses strongly expressed genes coding for secreted proteins (e.g. genes such as cellobiohydrolase I in Trichoderma reesei and glucoamylase in A. niger). The advantage of replacing the strongly expressed gene with the gene of interest is that the capacity of the secretory pathway that is naturally used for secretion of the endogenous protein can be used for secretion of the protein of interest [152]. Use of this gene-replacement approach can also eliminate unfavorable genes essential for the biosynthesis of mycotoxin, antibiotic, or other secondary metabolites (e.g. isocoumarins – Ref. [153] and references cited therein) in food-fermenting fungi. Because the frequency of hom*ologous integration in filamentous fungi is often very low, several methods have been developed to improve the efficiency of hom*ologous recombination. Michielse et al. [146] suggested combination of ATM with the TAGKO method (transposon-arryed gene knock-outs) [154], which has been reported to yield high hom*ologous integration frequency in Mycosphaerella graminicola and Magnaporthe grisea [155, 156]. The molecular mechanism of non-

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

hom*ologous recombination has been elucidated at the molecular level and termed “nonhom*ologous end-joining” (NHEJ) [157]. This process depends on protein kinase catalytic subunits Ku70 and Ku80. hom*ologs of Ku70 and Ku80 have been located in yeasts [157] and N. crassa [158]. In mutant strains of N. crassa in which Ku70 and Ku80 hom*ologs have been knocked out, exogenous DNA integrated hom*ologously at a frequency of 100% [158]. Detection of KU70 and KU80 hom*ologs in A. nidulans has recently been reported [159]; the genes were designated nkuA and nkuB, respectively. The single deletion of nkuA dramatically increased the frequency of hom*ologous integrations (from approximately 13% to 90%). They also could reduce hom*ologous flanking region to 500 bp to enable efficient gene targeting in an ΔnkuA strain. Ku70 and Ku80 hom*ologs will certainly be found in other fungi, with permit a higher rate of hom*ologous recombination. Heterologous integration does not require hom*ology between transforming DNA and target sites. In contrast with yeast, heterologous integration is favored in filamentous fungi. This results in transformants with high copy numbers and considerable mitotic stability [160]. A strict correlation between copy number and gene dosage is often not observed in such strains, however, because of the effects of position and titration. The position of integration seems to play a major role in the level of expression achieved, whereas limitation of transcription factors available could somewhat downsize the approach [161]. The use of autonomously replicating vectors is restricted, because of an almost complete lack of natural plasmids in hyphal fungi which could act as a basis for such vectors. The AMA (autonomous maintenance in Aspergillus) sequence of A. nidulans [162] confers autonomous replication of vectors on Aspergillus and other fungi, similar to the ARS sequence of S. cerevisiae. Penicillium nalgiovense, used as a starter for cured and fermented meat products, has been transformed with reasonably high mitotic stability and high transformation frequency using an AMA1-based plasmid [150]. Nevertheless, plasmids are easily lost when transformants are grown under nonselective conditions.

3.3.2 Application of RNA-based Methods for Strain Improvement

RNA interference (RNAi) is a new field that has been successfully applied to filamentous fungi [161]. This method enables interference in gene expression at the post-transcriptional level without altering the genetic background of the production strain. Takeno et al. [164] used the RNAi approach to improve the production of arachidonic acid (ARA) with Mortierella alpina. Another successful application of the RNAi approach is the increased expression of (wanted) glucose repressible genes by RNAi downregulation of creA in A. nidulans [165] without complete disruption of gene function. By use of this strategy, the unwanted impaired growth phenotype of a creA null mutant deletion strain [166], which renders such a strain not applicable for industrial exploitation, could be circumvented.

3.3 Filamentous Fungi

In addition to RNAi, hammerhead ribozymes can target virtually any mRNA sequence of choice and prevent gene expression at the post-transcriptional level. This method can also be applied to metabolic engineering of filamentous fungi [167]. RNAi and ribozyme techniques are the only methods available that modulate gene expression at the post-transcriptional level and enable fine tuning in comparison with deletion methods and thus can be useful for reducing gene products of multicopy genes or mRNAs of essential genes, where disruption would either be lethal or result in an undesirable phenotype.

3.3.3 Industrial Filamentous Fungi

Traditional food of plant origin, for example soy sauce in East Asia, cheese in Europe, and, nowadays, nutritional supplements (for example enzymes, vitamins, lipids, and a meat substitute) are produced using filamentous fungi (Section 3.1.1). This section focuses on exemplarily selected applications of filamentous fungi in food technology. Several properties of hyphal fungi make them an ideal host for hom*ologous and heterologous protein production. They have a naturally high-volume secretion system and the capacity for post-translational modifications. Fermentation processes have, furthermore, already been developed (antibiotics production) and molecular genetic methods are available for directed strain improvement. The filamentous fungi most widely used for protein production are A. niger, A. oryzae, and T. reesei [152]. Recently, a new fungus, Chrysosporium lucknowense, has been discovered and used for protein production, with some advantages, for example high transformation frequency, production at neutral pH, low viscosity (nonfilamentous strain), and short fermentation time [152].

3.3.3.1 Fungi Used for Fermentation of Plant Material Aspergillus, Rhizopus, and Mucor strains are used for fermentation of soybeans, rice, and peanut products (Table 3.1). In Japan these starter cultures are known as koji. Strains are selected for their specific enzymes. For soy sauce production, strains should have high proteolytic and amylolytic activity whereas strains for rice wine production should have high amylolytic activity to convert starch into sugar [2]. Strain improvement for koji molds should result in new strains with regard to production of desirable enzymes, aroma compounds, organic acids, and pigments, enhancement of characteristics for growth, and temperature and salt tolerance, for example. The method of choice is genetic breeding, i.e. the protoplast fusion technique. A variety of filamentous fungi, for example Aspergillus, Mucor, Penicillium and Trichoderma, have been subjected to intra and interspecific protoplast fusion. Principles and applications of genetic recombination of industrial koji molds have been carefully reviewed [168].

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

3.3.3.2 Fungal Oils and Other Metabolites Oils are produced by several molds (A. sydowii, Fusarium oxysporum, F. equiseti) [169], but single-cell oil production by filamentous fungi cannot compete commercially with lipids of plant origin. There is, however, a large market, e.g. in neonatal nutrition, for oils containing very long polyunsaturated fatty acids (PUFA), which are not available from plant sources [170]. Arachidonic acid (ARA) and docosahexaenoic acid (DHA), both absent from cow’s milk and infant formulas, have been found to be important for neural and retinal development. ARA and DHA are produced by several companies and have been reviewed by Ratledge [170]. There is an increasing demand of these two PUFA, with a market of up 1000 tons per year [170]. Other lipids produced by fungi (e.g. Mucor circinelloides) are gammalinoleic acid and cocoa butter substitutes [171]. Riboflavin (vitamin B2), produced by Ashbya gossypii, is an essential factor for humans and animals, because it is the precursor of flavoenzymes. It is used in the food industry as a supplement in multivitamin juices, and as a colorant (E101) in soft drinks and yoghurts. A naturally overproducing strain of A. gossypii is currently used to produce riboflavin. Purines are essential precursors for the biosynthesis of riboflavin. The de novo purine biosynthetic pathway is a highly regulated system with a direct affect on the yield of riboflavin. Manipulations to enhance the metabolic flow through the purine pathway could increase the production of riboflavin tenfold, to 228 mg mL−1 [172].

3.3.3.3 Fungal Proteins and Enzymes Thaumatin is a sweet protein (approx. 3000 times sweeter than sucrose) derived from the tropical plant Thaumatococcus danielii [173] and has been approved as food-grade ingredient [174]. Availability from the plant is very limited [175], and several attempts to heterologously express thaumatin in bacteria, yeast, and A. oryzae have failed. Successful expression has been achieved in P. roquefortii and A. niger var. awamori [176] at titers of 2–7 mg L−1. An increase of thaumatin production (14 mg L−1) was initially achieved by using strong fungal promoters to express thaumatin and higher gene dosage (14 copies). There was good correlation between gene copy number and secreted protein [177]. Similar results were obtained when aspergillopepsin, a fungal protease, was deleted [177]. The yield of thaumatin could also be increased 2 to 2.5-fold in A. awamori in comparison with the parental strain because of the overexpression of the chaperone BipA [178]. Overexpression of chaperones is a strategy commonly used to improve the expression of heterologous proteins in filamentous fungi. Xylanases are used as a supplement in animal feed, for the manufacture of bread, food and drink, textiles, bleaching of cellulose pulp, and ethanol and xylitol production. Among microbial sources, filamentous fungi (mainly A. niger, Trichoderma spp., and Humicola insolens.) secrete xylanases into the medium and levels are higher than those found in yeasts and bacteria [179]. Xylanases can be used to improve bakery products such as wheat–rye and whole meal bread. Application of xylanases results in easier kneading, increased loaf

3.3 Filamentous Fungi

volume, better crumb porosity, higher moisture, and an extended shelf life (Refs [179], and references cited therein, and Ref. [180]). Xylanases are also used in the juice and wine industry to aid the liquefaction of fruit and vegetables and the stabilization of the fruit pulp, to increase the recovery of aromas, essential oils, vitamins, mineral salts, edible dyes, pigments etc., to reduce viscosity, and for hydrolysis of substances that hinder clearing of the juice. The main advantage of using xylanases derived from filamentous fungi is high stability and optimum activity at acid pH [179]. Lipases can be used to alter the fatty acid composition of oils derived from plants or fish [171]. This is achieved by selective hydrolysis, which leads to accumulation of lipids where the lipases used are not specific for. Examples are eicosapentaenoic acid (EPA) and DHA in fish oils, which have been increased by use of lipases from Rhizopus niveus [181]. Lipases also play a role in flavor development and also affect the consistency of cheese. Blue cheese flavoring could be enhanced and accelerated using P. roquefortii lipases [182, 183]; in addition, rancidity of butter fat can be avoided by the removal of butyric acid by interesterification with A. niger lipase [171]. Ratledge [170] and Sancholle and Lösel [171] provide detailed information about lipid production and application of lipases. DSM Food Specialties is a leading producer of value-added ingredient solutions for the international food, feed, and beverage industries. DSM have screened 14,000 genes of the Aspergillus niger genome, for which they determined the DNA sequence in 2001. DSM have discovered that A. niger contains approximately 200 genes encoding proteases with a variety of functions; of these 60 are secreted, A. niger proteases are used to produce the PeptoPro energy-recovering drink. In addition DSM have found an A. niger asparaginase which can be used to prevent acrylamide formation [184] during food preparation.

3.3.3.4 Fungi as Single-cell Protein (SCP) During the early 1960s a variety of microorganisms were screened for production of SCP. A potential microbial protein should be cheap and easy to produce, palatable, and have a suitable taste and texture. Fusarium venenatum was chosen for development of a mycoprotein, and in 1984 this was approved for sale as a food product by the Ministry of Agriculture, Fisheries, and Food in the UK [185]. According to Wiebe [185], Quorn (brand name) has found a important market role in Europe as an alternative to meat for vegetarians and people seeking a healthier diet, because F. venenatum mycoprotein contains approximately 44% (w/w) protein (dry weight), all the essential amino acids are present, and it contains no cholesterol, is low in saturated fats [186], and comprises 25% fiber. Major advantages of fungal single-cell proteins is the low nucleic acid content compared with bacterial and yeast single-cell proteins, because high concentrations of purines causes articular gout, and in comparison with tofu the texture of Quorn is more meat-like. There are, however, concerns about the allergic potential of fungal proteins present in Quorn, and adverse gastrointestinal reactions have been reported [187].

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

3.4 Prospects

The biotechnology of yeast and filamentous fungi has been a very important issue in the last few decades and a large number of industries are highly dependent on improving the productivity of yeast and fungal production strains. Substantial progress has been made in developing novel food strains of yeasts and filamentous fungi by means of genetic engineering. Enormous effort has been devoted to research development of Saccharomyces cerevisiae strains (brewing yeast, wine yeast, bakers’ yeast) resulting in improved fermentation capacities which can enhance, for example, the sensory quality of bread or beer. In general, the public have a low opinion of genetically modified (GM) food. Mainly because industry fears negative consumer reaction, none of these GM strains has actually been used commercially. Only one GM yeast, produced at The Brewing Research Foundation International (BRFi), has received approval for use in beer production. “Nutfield Lyte”, a lowcalorie and low-alcohol beer, has been brewed for research purposes only. Beyond genetic engineering of food-relevant yeasts, many GM yeast strains have been developed and applied in the production of: 1. recombinant proteins (e.g. enzymes, inhibitors, interferons, hormones, antibodies); and 2. industrially useful chemicals (antibiotics, organic, amino, and fatty acids, vitamins, sterols and other biologically active substances). GM filamentous fungi are also used for the industrial production of, for example, enzymes, vitamins, pigments, and lipids. Filamentous fungi are also extremely effective at performing biotransformation processes, for example the production of steroids. The potential of GM yeast and filamentous fungi to produce numerous biological active substances may also affect modern food production. Conceivable applications for yeasts and filamentous fungi are in the production of functional food – the production of “positive” food additives, for example vitamins, organic acids, and prebiotic and bioactive substances. The resulting products would have a clear advantage over conventionally produced foods and could even prevent diseases or compensate for malfunctions. In fact, improvement of the nutrition value of food products is one of the most important challenges for the future.

Acknowledgments

We thank V. Meyer for useful discussions and R. Bensmann for correcting the English in the manuscript.

References

References 1 Bamforth, C. W. (1998) Tap into the art and science of brewing. Plenum Press, New York and London. 2 Wolf, G. (1997) Traditional fermented food, in: Fungal Biotechnology (Anke, T., Ed.), Chapman and Hall, Weinheim, pp. 3–13. 3 Tornai-Lehoczki, J., Dlauchy, D. (2000) Delimination of brewing yeast strains using different molecular techniques. Int. J. Food Microbiol. 62, 37–45. 4 Verachtert, H., Debourg, A. (1995) Properties of Belgian acid beers and their microflora. Cerev. and Biotech. 20 (1), 39–41. 5 Van der Aa Kuhle, A., Jesperen, L., Glover, R. L., Diawara, B., Jakobsen, M. (2001) Identification and characterization of Saccharomyces cerevisiae strains isolated from West African sorghum beer. Yeast 18, 1069–1079. 6 Attfield, P. V. (1997) Stress tolerance: The key to effective strains of industrial bakers’ yeast. Nat. Biotech. 15, 1351–1357. 7 Nakazato, A., Kadokura, T., Amano, M., Harayama, T., Murakami, Y., Takeda, M., Ohkuma, M., Kudo, T., Kaneko, T. (1998) Comparison of the structural characteristics of chromosome VI in Saccharomyces sensu stricto: the divergence, species-dependent features and uniqueness of sake yeasts. Yeast 14, 723–731. 8 Krämer, J. (1992) Lebensmittel-Mikrobiologie 2. Auflage, Eugen Ulmer, Stuttgart. 9 Zulu, R. M., Dillon, V. M., Owens, J. D. (1997) Munkoyo beverage, a traditional Zambian fermented maize gruel using Rhynchosia root as amylase source. Int. J. Food Microbiol. 34, 249–258. 10 Hayford, A.E., Jakobsen, M. (1999) Characterization of Candida krusei strains from spontaneously fermented maize dough by profiles of assimilation, chromosome profile, polymerase chain reaction and restriction endonuclease analysis. J. Appl. Microbiol. 87(1), 29–40. 11 Guerra, J. B., Araujo, R. A., Pataro, C., Franco, G. R., Moreira, E. S., MendoncaHagler, L. C., Rosa, C. A. (2001) Genetic diversity of Saccharomyces cerevisisae strains during the 24 h fermentative

cycle for the production of the artisanal Brazilian cachaca. Lett. Appl. Microbiol. 33, 106–111. Schwan R. F., Mendonca, A. T., da Silva Jr., J. J., Rodrigues, V., Wheals, A. E. (2001) Microbiology and physiology of Cachaca (Aguardente) fermentations, Antonie Van Leeuwenhoek 79, 89–96. Mortimer, R., Polsinelli, M. (1999) On the origins of wine yeast. Res. Microbiol. 150, 199–204. Walker, G. M. (1998) Yeast. Physiology and Biotechnology. John Wiley and Sons, Chichester. Teoh, A. L., Heard, G., Cox, J. (2004) Yeast ecology of Kombucha fermentation. Int. J. Food Microbiol. 95 (2), 119–126. Steels, H., James, S.A., Bond, C.J., Roberts, I.N., Stratford, M. (2002) Zygosaccharomyces kombuchaensis: the physiology of a new species related to the spoilage yeast Zygosaccharomyces lentus and Zygosaccharomyse bailii. Yeast 2, 113–21. Coton, E., Coton, M., Levert, D., Casaregola, S., Sohier, D.(2005) Yeast ecology in French cider and black olive natural fermentations. Int. J. Food Microbiol. (in press). Giannoutsou, E.P., Meintanis, C., Karagouni, A.D.(2004) Identification of yeast strains isolated from a two-phase decanter system olive oil waste and investigation of their ability for its fermentation. Bioresour Technol. 93(3), 301–6. Jansen, M., Veurink, J. H., Euverink, G. J., Dijkhuizen, L. (2003) Groth of a salttolerant yeast Zygosaccharomyces rouxii in microtiter plates: effects of NaCl, pH and temperature on growth and fusel alcohol production from branched-chain amino acids. FEMS Yeast Res. 3 (3), 313–318. Sujaya, I.N., Tamura, Y., Tanaka, T., Yamaki, T., Ikeda, T., Kikushima, N., Yata, H., Yokota, A., Asano, K., Tomita, F. (2003) Development of internal transcribed spacer regions amplification restriction fragment length polymorphism method and its application in monitoring the population of Zygosaccharomyces rouxii M2 in miso fermentation. J. Biosci. Bioeng. 96(5), 438–47.

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi 21 Eliskases-Lechner, F., Ginzinger, W. (1995) The yeast flora of surface ripened cheeses. Milchwissenschaft 50, 458–462. 22 Arif, K., Spinnler, H. E., Tache, R., Bonnarme, P. (2002) Production of volatile compounds by cheese-ripening yeasts: requirement for a methanethiol donor for S-methylthioacetate synthesis by Kluyveromyces lactis. Appl. Microbiol. Biotechnol. 58(4), 503–510. 23 Rantsiou, K., Urso, R., Iacumin, L., Cantoni, C., Cattaneo, P., Comi, G., Cocolin, L. (2005) Culture-dependent and -independent methods to investigate the microbial ecology of Italian fermented sausages. Appl. Environ. Microbiol. 71(4), 1977–86. 24 Kourkoutas, Y., Psarianos, C., Koutinas, A.A., Kanellaki, M., Banat, I.M, Marchant, R. (2002) Continuous whey fermentation using kefir yeast immobilized on delignified cellulosic material. J. Agric. Food Chem. 50(9), 2543–7. 25 Hinnen, A., Hicks, J. B. and Fink, G. R. (1978) Transformation of yeast. Proc. Natl. Acad. Sci. 75, 1929–33. 26 Goffeau, A., Barrell, B.G., Bussey, H., Davis, R.W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J.D., Jacq, C., Johnston, M., Louis, E.J., Mewes, H.W., Murakami, Y., Philippsen, P., Tettelin, H., Oliver, S.G. (1996) Life with 6000 genes. Sci. 274(5287), 546, 563–7. 27 Romanos, M. A., Scorer, C. A., Clare, J. J. (1992) Foreign gene expression in yeast: a review. Yeast 8, 423–488. 28 Sudbery, P. E. (1993) Genetic engineering of yeast, in: Biotechnology. Second Edition, Vol. 2 (Rehm, H.-J., Reed, G., Pühler, A., Stadler, P., Eds.), VCH Weinheim, pp. 507–528. 29 Hadfield, C. (1994) Construction of cloning and expression vectors, Molecular Genetics of Yeast. A practical approach (Johnston, J. R., Ed.), Oxford University Press, pp. 17–48. 30 Archer, D. B., MacKenzie D. A., Jeenes D. J. (2001) Genetic engineering: yeasts and filamentous fungi, in: Basic Biotechnology. Second Edition (Ratledge, C., Kristiansen B., Eds.), Cambridge University Press, pp. 95–126. 31 Gietz, R. D. and Woods, R. A. (2006) Yeast transformation by the LiAc/SS

Carrier DNA/PEG method. Methods Mol. Biol. 313, 107–20. Akada, R. (2002) Genetically modified industrial yeast ready for application. J. Biosci. Bioeng. 94, 536–44. Wolf, K., Breuning, K., Barth, G. (eds.): Non-conventional yeasts in genetics, biochemistry and biotechnology. Practical Protocols, Springer, Berlin, 2003. Porro, D., Sauer, M., Branduardi, P. and Mattanovich, D. (2005) Recombinant protein production in yeasts. Mol. Biotechnol. 31, 245–59. Hutchison, H. T., Hartwell, L. H. (1967) Macromolecule synthesis in yeast spheroplasts. J. Bacteriol. 94, 1697–1705. Kao, K. N., Michayluk, M. R. (1974) A method for high-frequency intergeneric fusion of plant protoplasts. Planta 115, 355–367. Ito, H., f*ckuda, Y., Murata, K., Kimura, A. (1983) Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153, 163–168. Klebe, R. J., Harriss, J. V., Sharp, Z. D., Douglas, M. G. (1983) A general method for polyethylene-glycol-induced genetic transformation of bacteria and yeast. Gene 25, 333–341. Yamakawa, M., Hishinuma, F., Gunge, N. (1985) Intact cell transformation of Saccharomyces cerevisiae by poly(ethylene glycol). Agric. Biol. Chem. 49, 869–871. Karube, I., Tamiya, E., Matsuoka, J. (1985) Transformation of Saccharomyces cerevisiae spheroplasts by high electric pulse. FEBS Lett. 182, 90–94. Hashimoto, H., Morikawa, H., Yamada, K., Kimura, A. (1985) A novel method for transformation of intact yeast cells by electroinjection of plasmid DNA. Appl. Microbiol. Biotechnol. 21, 336–339. Meilhoc, E., Masson, J. M. and Teissie, J. (1990) High efficiency transformation of intact yeast cells by electric field pulses. Biotechnology (NY) 8, 223–7. Becker, D. M., Guarente, L. (1991) Highefficiency transformation of yeast by electroporation. Methods Enzymol. 194, 182–187. Grey, M., Brendel, M. (1992) A ten-minute protocol for transforming Saccharomyces cerevisiae by electroporation. Curr. Genet. 22, 335–336.

References 45 Manivasakam, P., Schiestl, R. H. (1993) High efficiency transformation of Saccharomyces cerevisiae by electroporation. Nucl. Acids Res. 21, 4414–4415. 46 Costanzo, M. C., Fox, T. D. (1988) Transformation of yeast by agitation with glass beads. Genetics 120, 667–670. 47 Klein, T. M., Wolf, E. D., Wu, R., Sanford, J. C. (1987) High-velocity microprojection for delivering nucleic acids into living cells. Nature 327, 70–73. 48 Johnston, S. A., Anziano, P. Q., Shark, K., Sanford, J. C., Butow, R. A. (1988) Mitochondrial transformation in yeast by bombardment with microprojectiles. Science 240, 1538–1541. 49 Gietz, R. D, Woods, R. A. (2001) Genetic transformation of yeast. BioTechniques 30, 816–831. 50 Pribylova, L., Sychrova, H. (2003) Efficient transformation of the osmotolerant yeast Zygosaccharomyces rouxii by electroporation. J. Microbiol. Meth. 55, 481–4. 51 Suga, M., Kusanagi, I. and Hatakeyama, T. (2003) High osmotic stress improves electro-transformation efficiency of fission yeast. FEMS Microbiol. Lett. 225, 235–9. 52 Wu, S. and Letchworth, G. J. (2004) High efficiency transformation by electroporation of Pichia pastoris pretreated with lithium acetate and dithiothreitol. Biotechniques 36, 152–4. 53 Hinnen, A., Buxton, F., Chandury, B. Heim, J., Hottiger, T., Meyhack, B., Pohlig, G. (1995) Gene expression in recombinant yeast, in Gene Expression in Recombinant Miroorganisms (ed. A. Smith) Marcel Dekker Inc. New York, pp. 121–193. 54 Pronk, J. T. (2002) Auxotrophic yeast strains in fundamental and applied research. Appl. Environ. Microbiol. 68, 2095–100. 55 Gueldener, U., Heinisch, J., Koehler, G. J., Voss, D., Hegemann, J. H. (2002) A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucl. Acids Res 30, e23. 56 Webster, T. D. and Dickson, R. C. (1983) Direct selection of Saccharomyces cerevisiae resistant to the antibiotic G418 following transformation with a DNA vector

carrying the kanamycin-resistance gene of Tn903. Gene 26, 243–52. Gritz, L. and Davies, J. (1983) Plasmidencoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae. Gene 25, 179–88. Riley, J. H., Morten, J. E. and Anand, R. (1992) Targeted integration of neomycin into yeast artificial chromosomes (YACs) for transfection into mammalian cells. Nucl. Acids Res. 20, 2971–6. Goldstein, A. L. and McCusker, J. H. (1999) Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15, 1541–53. Raymond, C. K., Pownder, T. A. and Sexson, S. L. (1999) General method for plasmid construction using hom*ologous recombination. Biotechniques 26, 134–8, 140–1. Beggs, J. D. (1978) Transformation of yeast by a replicating hybrid plasmid. Nat. 275, 104–109. Rothstein, R. (1991) Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Methods Enzymol. 194, 281–301. Lopes, T. S., Klootwijk, J., Veenstra, A. E., van der Aar, P. C., van Heerikhuizen, H., Raue, H. A. and Planta, R. J. (1989) High-copy-number integration into the ribosomal DNA of Saccharomyces cerevisiae: a new vector for high-level expression. Gene 79, 199–206. Rosel, H. and Kunze, G. (1998) Integrative transformation of the dimorphic yeast arxula adeninivorans LS3 based on hygromycin B resistance. Curr. Genet. 33, 157–63. Lee, W. and Dasilva, N. A. (2006) Application of sequential integration for metabolic engineering of 1,2-propanediol production in yeast. Metab Eng. 8(1), 58–65. Parekh, R. N., Shaw, M. R. and Wittrup, K. D. (1996). An integrating vector for tunable, high copy, stable integration into the dispersed Ty delta sites of Saccharomyces cerevisiae. Biotechnol. Prog. 12, 16–21. Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F. and Cullin, C.

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi

(1993) A simple and efficient method for direct gene deletion in Saccharomyces cerevisiae. Nucl. Acids Res. 21, 3329–30. Alani, E., Cao, L. and Kleckner, N. (1987) A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116, 541–5. Langle-Rouault, F., Jacobs, E. (1995) A method for performing precise alterations in the yeast genome using a recycable selectable marker. Nucl. Acids Res. 23, 3079–81. Wach, A., Brachat, A., Pohlmann, R. and Philippsen, P. (1994) New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793–808. Sauer, B. (1987) Functional expression of the cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae. Mol. Cell Biol. 7, 2087–96. Güldener, U., Heck, S., Fiedler, T., Beinhauer, J., Hegemann, H. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucl. Acids Res. 24, 2519–2524. Storici, F., Coglievina, M., Bruschi, C. V. (1999) A 2-micron DNA-based marker recycling system for multiple gene disruption in the yeast Saccharomyces cerevisiae. Yeast 15, 271–83. Cereghino, J.L., Cregg, J.M. (2000) Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev. 24(1), 45–66. Wang, T. T., Choi, Y. J., Lee, B. H. (2001) Transformation systems of non-Saccharomyces yeasts. Crit. Rev. Biotechnol. 21, 177–218 Thor, D., Xiong, S., Orazem, C.C., Kwan, A.C., Cregg, J.M., Lin-Cereghino, J., Lin-Cereghino, G.P. (2005) Cloning and characterization of the Pichia pastoris MET2 gene as a selectable marker. FEMS Yeast Res. 5(10), 935–42. Lin-Cereghino, G.P., Lin-Cereghino, J., Sunga, A.J, Johnson, M.A., Lim, M., Gleeson, M.A., Cregg, J.M. (2001) New selectable marker/auxotrophic host strain combinations for molecular genetic manipulation of Pichia pastoris. Gene 263(1/2), 159–69.

78 Nett, J.H., Hodel, N., Rausch, S., Wildt, S. (2005) Cloning and disruption of the Pichia pastoris ARG1, ARG2, ARG3, HIS1, HIS2, HIS5, HIS6 genes and their use as auxotrophic markers. Yeast 22(4),295–304. 79 Lueking, A., Holz, C., Gotthold, C., Lehrach, H., Cahill, D. (2000) A system for dual protein expression in Pichia pastoris and Escherichia coli. Protein Expr. Purif. 20, 372–8. 80 Sohn, J. H., Choi, E. S., Kim, C. H., Agaphonov, M. O., Ter-Avanesyan, M. D., Rhee, J. S. and Rhee, S. K. (1996) A novel autonomously replicating sequence (ARS) for multiple integration in the yeast Hansenula polymorpha DL-1. J. Bacteriol. 178, 4420–8. 81 Bahler, J., Wu, J. Q., Longtine, M. S., Shah, N. G., McKenzie, A., 3rd, Steever, A. B., Wach, A., Philippsen, P., Pringle, J. R. (1998). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943–51. 82 Cregg, J. M., Cereghino, J. L., Shi, J., Higgins, D. R. (2000) Recombinant protein expression in Pichia pastoris. Mol. Biotechnol. 16, 23–52. 83 Gellissen, G. (2000) Heterologous protein production in methylotrophic yeasts. Appl. Microbiol. Biotechnol. 54, 741–750. 84 Madzak, C., Gaillardin, C. and Beckerich, J. M. (2004). Heterologous protein expression and secretion in the non-conventional yeast Yarrowia lipolytica: a review. J. Biotechnol. 109, 63–81. 85 Wang, Y.C., Chuang, L.L., Lee, F.W., da Silva, N.A. (2003) Sequential cloned gene integration in the yeast Kluyveromyces lactis. Appl. Microbiol. Biotechnol. 62(5/6), 523–7. 86 Nielsen, J. (2001) Metabolic engineering. Appl. Microbiol. Biotechnol. 55, 263–283. 87 Dequin, S. (2001) The potential of genetic engineering for improving brewing, wine-making and baking yeasts. Appl. Microbiol. Biotechnol. 56, 577–88. 88 Barnett, J. A. (1992) The taxonomy of the genus Saccharomyces Meyen ex Rees: a short review for non-taxonomists. Yeast 8, 1–23. 89 Kodama, Y., Nakao, Y., Nakamura, N., Fujimura, T., Shirahige, K., Ashikari, T. (2003) Diversity of the chromosomal

References structure in lager brewing yeasts. XXIth YGM Conference Göteborg, Sweden, http://www.yeast2003.se 90 Hansen, J., Kielland-Brandt, M. C. (1994) Saccharomyces carlsbergensis contains two functional MET2 alleles similar to hom*ologues from S. cerevisiae and S. monacensis. Gene 140, 33–40. 91 Pedersen, M. D. (1994) Molecular analysis of yeast DNA – tools for pure yeast maintenance in the brewery. J. Am. Soc. Brew. Chem. 52, 23–7. 92 Vaughan-Martini, A., Kurtzmann, C. P. (1985) Desoxyribonucleic acid relatedness amongst species of the genus Saccharomyces stricto sensu. Int. J. Syst. Bacteriol. 35, 5008–5011. 93 Turakainen, H., Kristo, P., Korhola, M. (1994) Consideration of the evolution of the Saccharomyces cerevisiae MEL gene family on the basis of the nucleotide sequences of the genes and their flanking regions. Yeast 10, 1559–1568. 94 Masneuf, I., Hansen, J., Groth, C., Piskur, J., Dubourdieu, D. (1998) New Hybrids between Saccharomyces Sensu Stricto Yeast Species Found among Wine and Cider Production Strains. Appl. Environ. Microbiol. 64(10), 3887–3892. 95 Pretorius, I. S. (2000) Tailoring wine yeast for the new millennium: novel approaches to the ancient art of winemaking, Yeast 16, 675–729. 96 Pedersen, M. B. (1986) DNA sequence polymorphism in the genus Saccharomyces IV. hom*ologous chromosomes III in Saccharomyces bayanus, S. carlsbergensis and S. uvarum. Carlsberg Res. Commun., 51, 185–202. 97 Hammond, J. R. M. (1995) Genetically-modified brewing yeasts for the 21st century. Progress to date. Yeast 11, 1613–1627. 98 Benitez, T. Gasent-Ramirez, J. M., Castrejon, F., Codon, A. C. (1996) Development of new strains for the food industry. Biotechnol. Prog. 12, 149–163. 99 Hansen J., Kielland-Brandt, M. C. (1996) Modification of biochemical pathways in industrial yeasts. J. Biotechnol. 49, 1–12. 100 Ostergaard, S., Olsson, L., Nielsen, J. (2000a) Metabolic engineering of Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 64, 34–50.

101 Hollenberg, C. P., Strasser, A. W. M. (1990) Improvement of bakers’ and brewers’ yeast by gene technology. Food Biotechnol. 4, 527–534. 102 Berghof, K., Stahl, U. (1991) Improving the filterability of beer by the use of β-glucanase active brewers’ yeast. BioEngineering 7, 27–32. 103 Volschenk, H., Viljoen, M., Grobler, J., Petzold, B., Bauer, F., Subden, R. E., Young, R. A., Lonvaud, A., Denayrolles, M., van Vuuren, H. J. J. (1997) Engineering pathways for malate degradation in Saccharomyces cerevisiae. Nat. Biotechnol. 15, 253–257. 104 Ostergaard, S., Roca, C., Ronnow, B., Nielsen, J., Olsson, L. (2000b) Physiological studies in aerobic batch cultivations of Saccharomyces cerevisiae strains harbouring the MEL1 gene. Biotechnol. Bioeng. 68, 252–259. 105 Nevoigt, E., Pilger, R., Mast-Gerlach, E., Schmidt, U., Freihammer, S., Eschenbrenner, M., Garbe, L., Stahl, U. (2002) Engineered Brewing Yeasts Overproducing Glycerol at the Expense of Ethanol. FEMS Yeast Res. 2, 225–232. 106 Verstrepen, K. J., Derdelinckx, G., Verachtert, H., Delvaux, F.R. (2003) Yeast flocculation: what brewers should know. Appl. Microbiol. Biotechnol. 61(3), 197–205. 107 Verstrepen, K., Bauer, F., Michiels, C., Derdelinckx, G., Delvaux, F., Pretorius, I. S. (2000) Controlled expression of FLO1 in Saccharomyces cerevisiae, EBC Monogr. 28, Symposium Yeast Physiology, Fachverlag Hans Carl, Nürnberg, pp. 30–42, 108 Omura, F., Shibano, Y., f*ckui, N., Nakatani, K. (1995) Reduction of hydrogen sulfide production in brewing yeast by constitutive expression of MET25 gene. J. Am. Soc. Brew. Chem. 53, 58–62. 109 Donalies, U. (2002) Genetische Optimierung der Sulfitbildung in Saccharomyces cerevisiae. Dissertation TU Berlin, Mensch und Buch 110 Donalies, U. E., Stahl, U. (2002) Increasing sulphite formation in Saccharomyces cerevisiae by overexpression of MET14 and SSU1.Yeast 19(6), 475–84. 111 Schaaff, I., Heinisch, J., Zimmermann, F. K. (1989) Overproduction of glycolytic enzymes in yeast. Yeast 5, 285–290.

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi 112 Vilanova, M., Blanco, P., Cortes, S., Castro, M., Villa, T. G., Sieiro, C. (2000) Use of a PGU1 recombinant Saccharomyces cerevisiae strain in oenological fermentations. J. Appl. Microbiol. 89, 876–883. 113 Perez-Gonzalez, J. A., Gonzalez, R., Querol, A., Sendra, J., Ramon, D. (1993) Construction of a recombinant wine yeast strain expressing β-(1,4)-endoglucanase and its use in microvinification processes. Appl. Environ. Microbiol. 59, 2801–2806. 114 Manzanares, P., Orejas, M., Gil, J. V., de Graaff, L. H., Visser, J. Ramon, D. (2003) Construction of a Genetically Modified Wine Yeast Strain Expressing the Aspergillus aculeatus rhaA Gene, Encoding an α-L-Rhamnosidase of Enological Interest. Appl. Environ. Microbiol. 69(12), 7558– 7562. 115 Lilly, M., Lambrechts, M. G., Pretorius, I. S. (2000) Effect of increased yeast alcohol acetyltransferase activity on flavor profiles of wine and distillates. Appl. Environ. Microbiol. 66, 744–753. 116 Remize, F., Roustan, J. L., Sablayrolles, J. M., Barre, P., Dequin, S. (1999) Glycerol overproduction by engineered Saccharomyces cerevisiae wine yeast strains leads to substantial changes in by-product formation and to a stimulation of fermentation rate in stationary phase. Appl. Environ. Microbiol. 65, 143–149. 117 Remize, F., Barnavon, L., Dequin, S. (2001) Glycerol export and glycerol3-phosphate dehydrogenase, but not glycerol phosphatase, are rate limiting for glycerol production in Saccharomyces cerevisiae. Metab. Eng. 3(4), 301–12. 118 Volschenk, H., Viljoen-Blom, M., Subden, R. E., van Vuuren, H. J. (2001), Maloethanolic fermentation in grape must by recombinant strains of Saccharomyces cerevisiae. Yeast 18, 963–970. 119 Sutherland, C. M., Henschke, P. A., Langridge, P., Lopes, M. D. (2003) Subunit and cofactor binding of S. cerevisiae sulfite reductase towards developing wine yeasts ability to produce hydrogen sulphide. Aust. J. Grape Wine Res. 9, 186–193. 120 Becker, J.V,, Armstrong, G.O., van der Merwe, M.J., Lambrechts, M.G., Vivier, M.A., Pretorius, I.S. (2003) Metabolic engineering of Saccharomyces cerevisiae for the synthesis of the wine-related anti-

oxidant resveratrol. FEMS Yeast Res. 4(1), 79–85. 121 Hirosawa, I., Aritomi, K., Hoshida, H., Kashigawi, S., Nishizawa, Y., Akada, R. (2004) Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol. Appl. Microbiol. Biotechnol. 65 (1), 68–73. 122 Aritomi, K., Hirosawa, I., Hoshida, H., Shigi, M., Nishizawa, Y., Kashigawi, S., Akada, R. (2004) Self-cloning yeast strains containing novel FAS2 mutations produce a higher amount of ethyl caproate in Japanese sake. Biosci. Biotech. Biochem. 68 (1), 206–214. 123 Klein, C. J. L., Olsson, L., Ronnow, B., Mikkelsen, J. D., Nielsen, J. (1997) Glucose and maltose metabolism in MIG1disrupted and MAL-constitutive strains of Saccharomyces cerevisiae, Food Technol. Biotechnol. 35, 287–292. 124 Klein, C. J. L., Rasmussen, J., Ronnow, B., Olsson, L., Nielsen, J. (1999), Investigation of the impact of MIG1 and MIG2 on the physiology of Saccharomyces cerevisiae, J. Biotechnol. 68, 197–212. 125 Blom, J., De Mattos, M. J. T., Grivell, L. A. (2000) Redirection of the respiro-fermentative flux distribution in Saccharomyces cerevisiae by overexpression of the transcription factor Hap4p. Appl. Environ. Microbiol. 66, 1970–1973. 126 Peinado, R. A., Moreno, J. J., Medina, M., Mauricio, J. C. (2005) Potential application of a glucose-transport-deficient mutant of Schizosaccharomyces pombe for removing gluconic acid from grape must. J. Agri. Food Chem. 53 (4), 1017–1021. 127 Aoki, T., Uchida, K. (1991) Enhanced formation of 3-(methylthio)-1-propanol in a salt-tolerant yeast, Zygosaccharomyces rouxii, due to deficiency of S-adenosylmethionine synthase. Agric. Biol. Chem. 55, 2113–2116. 128 Case, M.E., Schweizer, M., Kushner, S.R., Giles, N.H. (1979) Efficient transformation of Neurospora crassa by utilizing hybrid plasmid DNA. Proc. Natl. Acad. Sci. 76 (10), 5259–63. 129 Ballance, D.J., Buxton, F.P., Turner, G. (1983) Transformation of Aspergillus nidulans by the orotidine-5-phosphate decarboxylase gene of Neurospora crassa.

References Biochem. Biophys. Res. Commun. 112 (1), 284–9. 130 Tilburn, J., Scazzocchio, C., Taylor, G.G., Zabicky-Zissman, J.H., Lockington, R.A., Davies, R.W. (1983) Transformation by integration in Aspergillus nidulans. Gene 6 (2/3), 05–21. 131 Yelton, M.M., Hamer, J.E., Timberlake, W.E. (1984) Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. 81 (5), 1470–4. 132 Miller, J.F. (1994) Bacterial transformation by electroporation. Meth. Enzymol. 235, 375–85. 133 Rakoczy-Trojanowska, M. (2002) Alternative methods of plant transformation – a short review. Cell. Mol. Biol. Lett. 7 (3), 849–58. 134 Chakraborty, B.N., Patterson, N.A., Kapoor, M. (1991) An electroporation-based system for high-efficiency transformation of germinated conidia of filamentous fungi. Can. J. Microbiol. 37 (11), 858–63. 135 Kothe, G.O., Free, S.J. (1996) Protocol for the Electroporation of Neurospora Spheroplasts. Fung. Gen. Newslett. 43, 31–33. 136 Sánchez, O., Aguirre, J. (1996) Efficient transformation of Aspergillus nidulans by electroporation of germinating conidia. Fun. Gen. Newslett. 43, 31–33. 137 Ozeki, K., Kyoya, F., Hizume, K., Kanda, A., Hamachi, M., Nunokawa, Y. (1994) Transformation of intact Aspergillus niger by electroporation. Biosci. Biotechnol. Biochem. 58(12), 2224–7. 138 Armaleo, D., Ye, G.N., Klein, T.M., Shark, K.B., Sanford, J.C., Johnston, S.A. (1990) Biolistic nuclear transformation of Saccharomyces cerevisiae and other fungi. Curr Genet. 17(2), 97–103. 139 Ruiz-Diez, B. (2002) Strategies for the transformation of filamentous fungi. J. Appl . Microbiol. 92 (2), 189–95. 140 Meyer, V., Mueller, D., Strowig, T., Stahl, U. (2003) Comparison of different transformationmethods for Aspergillus giganteus.Curr Genet. 43 (5), 371–7. 141 de Groot, M.J., Bundock, P. Hooykaas, P.J., Beijersbergen, A.G. (1998) Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat Biotechnol. 16(9), 839–42. Erratum in: Nat Biotechnol (1998) 16(11), 1074.

142 Michielse, C.B., Salim, K., Ragas, P., Ram, A.F., Kudla, B., Jarry, B., Punt, P.J., van den Hondel, C.A. (2004) Development of a system for integrative and stable transformation of the zygomycete Rhizopus oryzae by Agrobacterium-mediated DNA transfer. Mol Genet Genomics. 271(4), 499–510. 143 Vijn, I., Govers, F. (2003) Agrobacterium tumefaciens mediated transformation of the oomycete plant pathogen Phytophthora infestans. Mol. Plant Pathol. 4 (6), 459–467. 144 Degefu, Y., Hanif, M. (2003) Agrobacterium tumefaciens-mediated transformation of Helminthosporium turcicum, the maize leaf-blight fungus. Arch Microbiol. 180 (4), 279–84. 145 Bundock, P., Hooykaas, P.J. (1996) Integration of Agrobacterium tumefaciens T-DNA in the Saccharomyces cerevisiae genome by illegitimate recombination. Proc. Natl. Acad. Sci. 93 (26), 15272–5. 146 Michielse, C.B., Hooykaas, P.J., van den Honde, C.A., Ram, A.F. (2005) Agrobacterium-mediated transformation as a tool for functional genomics in fungi. Curr Genet. 48 (1), 1–17. 147 Punt, P.J., van den Hondel, C.A. (1992) Transformation of filamentous fungi based on hygromycin B and phleomycin resistance markers. Meth. Enzymol. 216, 447–57. 148 d’Enfert, C. (1996) Selection of multiple disruption events in Aspergillus fumigatus using the orotidine-5-decarboxylase gene, pyrG, as a unique transformation marker. Curr. Genet. 30(1), 76–82. 149 Daboussi, M.J., Djeballi, A., Gerlinger, C., Blaiseau, P.L., Bouvier, I., Cassan, M., Lebrun, M.H., Parisot, D., Brygoo, Y. (1989) Transformation of seven species of filamentous fungi using the nitrate reductase gene of Aspergillus nidulans. Curr Genet. 15 (6), 453–6. 150 Fierro, F., Laich, F., Garcia-Rico, R.O., Martin, J.F. (2004) High efficiency transformation of Penicillium nalgiovense with integrative and autonomously replicating plasmids. Int. J. Food Microbiol. 90 (2), 237–48. 151 Yu, J.H., Hamari, Z., Han, K.H., Seo, J.A., Reyes-Dominguez, Y., Scazzocchio, C. (2004) Double-joint PCR: a PCR-based

3 Fermentation of Food by Means of Genetically Modified Yeast and Filamentous Fungi molecular tool for gene manipulations in filamentous fungi. Fung. Gen. Biol. 41 (11), 973–81. 152 Nevalainen, K.M., Te’o, V.S., Bergquist, P.L. (2005) Heterologous protein expression in filamentous fungi.Trends Biotechnol. 23 (9), 468–74. 153 Larsen, T.O., Breinholt, J. (1999) Dichlorodiaportin, diaportinol, and diaportinic acid: three novel isocoumarins from penicillium nalgiovense. J. Nat. Prod. 62 (8), 1182–4. 154 Lo, C., Adachi, K., Shuster, J.R., Hamer, J.E., Hame, L. (2003) The bacterial transposon Tn7 causes premature polyadenylation of mRNA in eukaryotic organisms: TAGKO mutagenesis in filamentous fungi. Nucleic Acids Res. 31 (16), 4822–7. 155 Adachi, K., Nelson, G.H., Peoples, K.A., Frank, S.A., Montenegro-Chamorro, M.V., DeZwaan, T.M., Ramamurthy, L., Shuster, J.R., Hamer, L., Tanzer, M.M. (2002) Efficient gene identification and targeted gene disruption in the wheat blotch fungus Mycosphaerella graminicola using TAGKO. Curr Genet. 42 (2), 123–7. 156 Hamer, L., Adachi, K., MontenegroChamorro, M.V., Tanze, M.M., Mahanty, S.K., Lo, C., Tarpey, R.W., Skalchunes, A.R., Heiniger, R.W., Frank, S.A., Darveaux, B.A., Lampe, D.J., Slater, T.M., Ramamurthy, L., DeZwaan, T.M., Nelson, G.H., Shuster, J.R., Woessner, J., Hamer, J.E. (2001) Gene discovery and gene function assignment in filamentous fungi. Proc. Natl. Acad. Sci. 98 (9), 5110–5. 157 Dudasova, Z., Dudas, A., Chovanec, M. (2004) Non-hom*ologous end-joining factors of Saccharomyces cerevisiae. FEMS Microbiol. Rev. 28 (5), 581–601. 158 Ninomiya, Y., Suzuki, K., Ishii, C., Inoue, H. (2004) Highly efficient gene replacements in Neurospora strains deficient for nonhom*ologous end-joining. Proc. Natl. Acad. Sci. 101 (33), 12248–53. 159 Nayak, T., Szewczyk, E., Oakley, C.E., Osmani, A., Ukil, L., Murray, S.L., Hynes, M.J., Osmani, S.A., Oakley, B.R. (2005) A versatile and efficient gene targeting system for Aspergillus nidulans. Genetics. Dec 30 (n press) 160 Tudzynski, P., Tudzynski, B. (1997) Fungal genetics: novel techniques and regulation circuits, in: Fungal Biotechnol-

ogy (Anke T., Ed.), Chapman and Hall, Weinheim, pp. 229–249. 161 Turner, G. (1997) Genetic engineering of filamentous fungi, in Biotechnology (Rehm HJ, Reed G, Pühler H, Stadler P, Eds.), VCH Weinheim, Second Edition, Vol. 2 pp. 529–543. 162 Gems, D., Johnstone, I.L., Clutterbuck, A.J. (1991) An autonomously replicating plasmid transforms Aspergillus nidulans at high frequency. Gene. 98 (1), 61–7. 163 Kitamoto, N., Yoshino, S., Ohmiya, K., Tsukagoshi, N. (1999) Sequence analysis, overexpression, and antisense inhibition of a beta-xylosidase gene, xylA, from Aspergillus oryzae KBN616. Appl. Environ. Microbiol. 65 (1), 20–4. 164 Takeno, S., Sakuradani, E., Tomi, A., Inohara-Ochiai, M., Kawashima, H., Ashikari, T., Shimizu, S. (2005) Improvement of the fatty acid composition of an oilproducing filamentous fungus, Mortierella alpina 1S-4, through RNA interference with delta12-desaturase gene expression. Appl. Environ. Microbiol. 71 (9), 5124–8. 165 Bautista, L.F, Aleksenko, A., Hentzer, M., Santerre-Henriksen, A., Nielsen, J. (2000) Antisense silencing of the creA gene in Aspergillus nidulans. Appl. Environ. Microbiol. 66 (10), 579–81. 166 Shroff, R.A., O’Connor, S.M., Hynes, M.J., Lockington, R.A., Kelly, J.M. (1997) Null alleles of creA, the regulator of carbon catabolite repression in Aspergillus nidulans. Fung. Gen. Biol. 22 (1), 28–38. 167 Mueller, D., Stahl, U., Meyer, V. (2005) Application of hammerhead ribozymes in filamentous fungi. J. Microbiol. Methods. Nov 17 (in press) 168 Ogawa, K. (1994) Approaches to hybridisation and appliedgenetics by protoplast fusion: koji-moulds and mushrooms, in: Recombinant microbes for industrial and agriculture applications (Murooka, Y and Imanaka T, Eds.), Marcel Dekker Inc., New York , pp. 581–603. 169 Azeem, A., Neelagund, Y.F., Rathod, V. (1999) Biotechnological production of oil: fatty acid composition of microbial oil. Plant Foods Hum Nutr. 53 (4), 381–6. 170 Ratledge, C. (2004) Fatty acid biosynthesis in microorganisms being used for Single Cell Oil production. Biochimie. 86 (11), 807–15.

References 171 Sancholle, M., Lösel, D. (1996) Lipids in fungal biotechnology, in: The mycota. II. Genetics and biotechnology (Kück, U., Ed.), Springer, Berlin, pp. 339–367. 172 Jimenez, A., Santos, M.A., Pompejus, M., Revuelta, J.L. (2005) Metabolic engineering of the purine pathway for riboflavin production in Ashbya gossypii. Appl. Environ. Microbiol. 71 (10), 5743–51. 173 Witty, M., Higginbotham, J.D. (Editors) (1994) in: Thaumatin. CRC Press, 174 Adrio, J.L., Demain, A.L. (2003) Fungal biotechnology. Int Microbiol. 6 (3), 191–9. 175 Zemanek, E.C., Wasserman, B.P. (1995) Issues and advances in the use of transgenic organisms for the production of thaumatin, the intensely sweet protein from Thaumatococcus danielli. Crit. Rev. Food Sci. Nutr. 35 (5), 455–66. 176 Faus, I. (2000) Recent developments in the characterization and biotechnological production of sweet-tasting proteins. Appl. Microbiol. Biotechnol. 53 (2), 145–51. 177 Moralejo, F.J., Cardoza, R.E., Gutierrez, S., Martin, J.F. (1999) Thaumatin production in Aspergillus awamori by use of expression cassettes with strong fungal promoters and high gene dosage. Appl. Environ. Microbiol. 65 (3), 1168–74. 178 Lombrana, M., Moralejo, F.J., Pinto, R., Martin, J.F. (2004) Modulation of Aspergillus awamori thaumatin secretion by modification of bipA gene expression. Appl Environ Microbiol. 70 (9), 5145–52. 179 Polizeli, M.L., Rizzatti, A.C., Monti, R., Terenzi, H.F., Jorge, J.A., Amorim, D.S.

(2005) Xylanases from fungi: properties and industrial applications. Appl. Microbiol. Biotechnol. 67 (5), 577–91. 180 Romanowska, I., Polak, J., Janowska, K., Bielecki, S. (2003) The application of fungal endoxylanase in bread-making. Commun. Agric. Appl. Biol. Sci. 68 (2), 317–20. 181 Yadwad, V. B., Ward, O. P., Noronha, L. C. (1991) Application of lipase to concentrate the docosahexaenoic acid (DHA) fraction of fish oil. Biotech. Bioeng. 38 (8), 956–959. 182 Revah, S., Lebeault, J. (1989) Accelerated Production of Blue Cheese Flavors by Fermentation on Granular Curds with Lipase Addition. Le Lait 69, 281– 289. 183 Huang, H. T., Dooley, J. G. (1976) Enhancement of cheese flavors with microbial esterases. Biotech. Bioeng. 18 (7), 909–919. 184 Blank, I. (2005) Current status of acrylamide research in food: measurement, safety assessment, and formation. Ann N Y Acad Sci. 1043, 30–40. 185 Wiebe, M.G. (2002) Myco-protein from Fusarium venenatum: a well-established product forhuman consumption. Appl. Microbiol. Biotechnol. 58(4), 421–7. 186 Turnbull, W.H., Leeds, A.R., Edwards, G.D. (1990) Effect of mycoprotein on blood lipids. Am. J. Clin. Nutr. 52 (4), 646–50. 187 Katona, S.J., Kaminski, E.R. (2002) Sensitivity to Quorn mycoprotein (Fusarium venenatum) in a mould allergic patient. J. Clin. Pathol. 55 (11), 876–7.

4 Production of Food Additives Using Filamentous Fungi Carsten M. Hjort

4.1 Filamentous Fungi in Food Production

Fungi are eukaryotic microorganisms that have been used as foods or to manufacture food for more than a thousand years. The fungal kingdom consists of yeasts that are unicellular organisms and of filamentous fungi that are multicellular organisms with the cells organized in chains known as hyphae. The hyphae can be branched to different extents. Some fungi are dimorphic, meaning they have both unicellular and filamentous growth stages. Yeasts have been used extensively for food production. The yeast Saccharomyces cerevisiae (bakers’ yeast) is used in baking, brewing, and winemaking. In all of these applications the ability to ferment glucose to ethanol and carbon dioxide is the key property of the yeast. Since the advent of recombinant production technology, a variety of yeasts have been used for production of enzymes and metabolites. Recombinant expression systems suitable for large-scale production have been developed for Saccharomyces cerevisiae, Schizosaccharomyces pompe, Pichia pastoris, Pichia methanolica, Hansenula polymorpha, Klyveromyces lactis, Yarrowia lipolytica, and other species [1, 2]. For production of food enzymes, filamentous fungi are, however, much more widely used than yeast systems. Filamentous fungi have been used in food production for a very long time. Sometimes the fungus is the food itself. Mushroom (Agaricus bisporus) is one example; more recently the ascomycete Fusarium venenatum was developed as a single-cell protein food source marketed under the name “Quorn” by the company Marlow foods [3]. Occasionally the fungus is an ingredient in the food, for example in cheese, in which a variety of species of Penicillium (e.g. P. roqueforti and P. camemberti) is part of the cheese product. The oldest examples of the use of filamentous fungi in food production are their use for fermentation of the food. In Japan the filamentous fungi Aspergillus oryzae (Fig. 4.1), Aspergillus sake, and related species have been used for fermenting sake, shoyu, and miso. In these processes the fungus ferments sugar to alcohol, but equally important is that the

4.1 Filamentous Fungi in Food Production

Fig. 4.1 Aspergillus oryzae agar culture. A strain of Aspergillus oryzae was grown on an agar plate. The picture shows different stages of sporulating phialides.

fungus secretes enzymes-like proteases and amylases that modify the raw material into the desired product. The potential of the enzyme complex produced by Aspergillus oryzae for the food industry was acknowledged late in the nineteenth century. In 1894 the Japanese–American enzyme pioneer Jockichi Takamine started manufacture, in a small plant in Chicago, of an enzyme complex from Aspergillus oryzae that was marketed under the trade name Takadiastase [4]. Later, in the 1950s, the submerged fermentation industry was developed in the United states. Aspergillus oryzae was developed to produce an array of different enzyme products by submerged fermentation, still with emphasis on proteases and amylases. Other Aspergillus species, for example the black Aspergilli, Aspergillus niger, Aspergillus awamori, Aspergillus fetidus, Aspergillus aculeatus, and Aspergillus japonicus were also used, mainly for production of the enzyme glucoamylase [5]. This enzyme was the basis for the enzyme revolution in the starch industry. Traditionally, starch was hydrolyzed to glucose in a process using hydrochloric acid, followed by neutralization. In this process several byproducts were formed, and large quantities of salt were produced in the neutralization step. By introducing enzymatic hydrolysis byproduct formation was avoided so a product of a better quality could be manufactured at a lower price. Aspergillus niger has also been used for production of bulk quantities of primary metabolites, for example citric acid [5]. So fermentation process development was conducted for production of enzymes and metabolites. The production strains were also dramatically improved by mutagenesis of the strains using chemicals or radiation then yield screening. Although major improvements were achieved by classical strain improvement and fermentation optimization, recombinant DNA technology revolutionized microbial enzyme production. The reasons for this are many. First, it is possible to produce enzymes isolated from virtually any organism in good yields in a highly developed safe expression system. Accumulated toxicity and safety studies for the

4 Production of Food Additives Using Filamentous Fungi

products produced in these systems has resulted in very good documentation of the safety of these products. In this way several different enzyme products can be produced in the same production equipment using essentially the same production process. Second, the host organism (the organism into which the foreign DNA is transferred) can be modified to suit the quality specifications of the enzyme product. These modifications include removal of unwanted side-activity, resulting in product purity that cannot be achieved by use of non recombinant methods. The fermentation yields of the enzymes can also be increased, often severalfold, compared with the yields that can be obtained from the donor organism. Finally, by use of recombinant DNA technology genetically engineered enzymes can be produced. Genetically engineered enzymes range from enzymes in which one or more amino acids are substituted for other amino acids to enzymes that are hybrids of those produced by two or more enzyme genes. By genetic engineering, enzymes with substantially improved properties can be obtained. At the dawn of the recombinant production age, one of the first, and one of the most critical, choices that had to be made was the choice of expression systems. Extensive experience with the Aspergilli made them obvious candidates as host organisms. First, they were known to be capable of producing huge amounts of extracellular protein. They were well suited for production in submerged cultures in stainless-steel tanks and mutants that were even better adapted to this production environment had been selected. Because of the long use of Aspergillus oryzae [6] and Aspergillus niger [7] as production organisms for food enzymes, products from these organisms had been recognized as GRAS (generally regarded as safe) for several years by the FDA. Although Aspergillus species such as Aspergillus oryzae [8], Aspergillus niger, and Aspergillus awamori [9] are dominant in enzyme production, other fungal systems have also been successfully developed. Trichoderma reesei a.k.a. Trichoderma longibrachiatum is a wood-degrading fungus that first attracted attention because of its ability to produce huge amounts of cellulases and hemicellulases. T. reesei proved to be suitable for submerged fermentation and was developed as an expression system [10]. A new fungal expression system, the Fusarium venenatum expression system, has recently been developed [11]. Fusarium venenatum is used for single-cell protein production, as mentioned above. One of the key characteristics of this fungus is that it is well suited for submerged fermentation. It is easy to aerate, as a consequence of the rheological properties of a Fusarium venenatum broth. Use of the fungus as a food formed as the basis for establishing the history of safe use. Recombinant DNA technology has not only been used as a tool for improved enzyme production systems. By manipulating the metabolism of the fungus it has been suggested to increase the yields of desired metabolites, for example citric acid [12], to eliminate unwanted metabolites, e.g. oxalic acid [13], or to enable production of metabolites foreign to the fungus, for example astaxanthin [14]. Such manipulation of the metabolism is referred to as metabolic engineering.

4.3 Design of Genetically Modified Microorganisms for Production

4.2 Additives for the Food Industry

The food industry uses additives of microbial origin for many different purposes. Today, enzymes are the best established example of substances produced using genetically modified microorganisms (GMMs) that are used for food production. Enzymes have been used in the food industry for thousands of years. Chymosin isolated from calves has been used in cheese making, amylases produced by barley have been used in brewing, and amylases and pectinases produced by grapes have been used in wine making, to mention just three examples. The deliberate use of microbial enzymes is a more recent development and enzymes produced by GMMs were not introduced for use in the food industry until the late eighties. Depending on in which country the enzymes are used, such enzymes are classified as food additives or as food-processing aids. The starch industry uses the largest amounts of enzymes by volume. Alfa amylases and amyloglycosidase are used to degrade starch into glucose. Part of the glucose syrup formed is processed further – glucose isomerase is used to convert the glucose into fructose for production of high-fructose corn syrups. In the baking industry amylases and xylanases are used to improve the quality of bread by giving it more volume, a better crumb structure, and a longer shelf life. More recently lipases have been introduced to baking to enable in situ formation of emulsifiers. In the diary industry chymosin extracted from calves for cheese production has been supplemented with proteases of microbial origin. Chymosin produced by recombinant Aspergillus niger has also become a quite important product. Enzymes other than the rennet proteases are used in the diary industry. For example, lactase is used to hydrolyze lactose. Such microbial lactase is of benefit to people suffering from lactose intolerance. Microbial amylases are used in the brewing industry to achieve a more robust and efficient mashing process. Enzymes have also been developed to remove the bad tasting metabolite diacetyl from beer. Because beer is seen by many as a very traditional product, however, many countries strictly regulate the types of additive which may be used in brewing. The wine industry is another example of a conservative industry in which the penetration of microbial enzymes is slow. This is especially true for enzymes produced by recombinant microorganisms. Pectinases are used to increase juice yield during mashing. Betaglucanases are used to remove haze resulting from Botrytis growth on the grapes. A more curious use of enzymes in this industry is the use of laccases to preserve cork stoppers, to prevent cork off-flavor in the wine.

4.3 Design of Genetically Modified Microorganisms for Production of Food Additives and Processing Aids

Enzymes are the most important examples of food additives and food-processing aids produced by use of GMMs, so in this section a thorough description of the

4 Production of Food Additives Using Filamentous Fungi

development of host strains and expression vectors for enzyme production will be provided. A brief description of tools for production of metabolites will also be given. As already mentioned, Aspergillus oryzae is one of the most important filamentous fungi used for recombinant production of enzymes. Aspergillus oryzae was selected as host strain because of a history of safe use for products with GRAS status, because of experience already gained using this organism for production, and because of the huge protein production potential of this microorganism. The production of, especially, amylases and proteases by this fungus was, however, also a major drawback. Two primary requirements when producing enzymes are product purity and product stability. When producing a given enzyme, the presence of amylases is unwanted, because this is contaminating protein and the amylase activity may even give some unwanted side-reactions. The presence of host strain proteases is also unwanted, because these proteases are not merely contaminating proteins, they may have a dramatic negative effect on the stability of the enzyme product. These unwanted enzymes activities have, therefore, to a very large extent, been removed; the most important tool for this is gene disruption [15]. Gene disruption has also been widely used for improvement of the Aspergillus niger, Trichoderme reesei, and Fusarium venenatum expression systems. The basic steps for disrupting a gene are: 1. the gene to be disrupted is cloned as a genomic clone with 1–2 kb (kilobase pairs) of the upstream and downstream sequence (i.e. 1000–2000 base pairs preceding the coding sequence of the gene and 1000–2000 after the coding sequence); 2. part or all of the coding sequence is replaced with a selectable marker to form the gene-disruption plasmid; 3. the gene disruption plasmid is linearized (typically by digesting it with a restriction enzyme) and subsequently transferred into the fungus; and 4. transformants are recovered using the selection system of the disruption plasmid and the transformants are then screened for the desired genotype. The gene-disruption event is outlined in Fig. 4.2. The pyrG (orotidine-5-phosphate decarboxylase) marker shown in the example is an auxotrophic marker that is widely used in Aspergillus oryzae and in other Aspergilli for gene disruption [16]. It is a biosynthetic gene in the pyrimidine pathway. It requires that the strain to be transformed is pyrG negative. The advantage of this marker is that it is bidirectional, that is, selection for both the presence and absence of the marker is possible. Selection for the presence of pyrG is achieved simply by transforming a pyrG negative strain and selection on a minimal medium for pyrimidine prototrophy (only cells having an intact pyrG gene can grow on such plates). Selection for the absence of the pyrG gene is achieved by plating out on a minimal medium containing uridine and the compound 5-fluoroorotic acid. Addition of the uridine will enable cells to grow without a functional pyrG gene and 5-fluoroorotic acid enables counter selection for the pyrG gene. This compound is converted into a toxic product by cells harboring a functional pyrG gene.

100

4.3 Design of Genetically Modified Microorganisms for Production pyrG 5’ upstream

pyrG 5’ repeat NP I 3’ downstream sequence

NP I 5’ upstream sequence

pyrG

Disruption plasmid

pyrG 5’ repeat pyrG 3’

Genome of mother strain. NP I 5’ upstream sequence

NP 1

pyrG 5’ upstream

NP I 3’ downstream sequence

pyrG 5’ repeat NP I 3’ downstream sequence

NP I 5’ upstream sequence

pyrG Genome of transformant.

pyrG 5’ repeat pyrG 3’

Fig. 4.2 Gene disruption in filamentous fungi. The principle is illustrated by disruption of the gene NP I. A disruption plasmid was made by replacing the coding part of the NP I gene with the selectable marker pyrG (orotidine-5-phosphate decarboxylase). The details of the components involved are described in the main text.

In this example a repeating sequence flanking the pyrG selection cassette has been included (pyrG 5 repeat). Recombination between the repeats results in the loss of the pyrG gene, and so these repeats greatly facilitate selection of a pyrG negative strain with a predictable genotype for subsequent gene disruption.

The bidirectional pyrG selection system is a very convenient tool for sequential disruption of several genes. A disruption plasmid is constructed for each of the genes that should be disrupted and a pyrG negative mutant of the selected host strain is isolated using 5-fluoroorotic acid. The pyrG mutant is then transformed with the first selection plasmid using selection for pyrimidine prototrophy. Transformants with the correct genotype, typically confirmed by Southern blot analysis [17], are then counter-selected for pyrG. The resulting strain is then ready for a new round of gene disruption using the next gene-disruption plasmid. Other bidirectional markers are known, for example the niaD (nitrate reductase) system [18], but the pyrG system is most applied. It is evident from Fig. 4.2 that the gene-disruption event leads to major changes in the DNA sequence of the effected locus. These changes are irreversible, meaning they will be present in all strains later in the pedigree of that particular host strain. They will thus also be present in transformants transformed with a particular product gene which is in the final GMM used for production. The gene disruption locus is thus an obvious target for analysis for the presence of DNA from the final GMM. In this way recombinant host-strain DNA may be detected, but if this host strain has been used for more products, it cannot reveal the specific product of the GMM.

4 Production of Food Additives Using Filamentous Fungi

By use of gene disruption several amylase, glycoamylase, and protease genes have been disrupted in Aspergillus oryzae, Aspergillus niger, and Aspergillus awamori. Very similar technology has been used to disrupt cellulose genes in Trichoderma reesei and metabolic pathways in Fusarium venenatum [19] and in Aspergillus niger [13]. Rather than disrupting all of the individual genes it is also possible to disrupt global activators that regulate the expression of entire classes of enzymes. For example, in Aspergillus niger a general protease regulator activates the expression of a range of extra cellular proteases. By just disrupting this single gene all of these proteases are silenced [20]. Development of the host strain is very important to the efficiency of the expression system and the quality of the final product, and host-strain improvement generates sequence tags in the final GMM suitable for analysis. The expression vector is the other leg in the final GMM, and the expression vector is usually specific for the product that should be expressed and, therefore, a natural target for analysis when analyzing for a specific product. Expression vectors in general consist of the following elements: 1. the gene encoding the product to be produced; 2. a promoter to drive expression of the product gene; this promoter can be a promoter developed for the expression system, that is a generic promoter, or it can be a promoter specific to the product gene, typically the product gene’s own promoter; 3. a translational terminator; just like the promoter, this can be a terminator generic for the expression system or it can be a specific terminator, typically the terminator of the product gene; 4. a selection marker for selection in the expression host; and 5. additional vector elements used to build the vector, for example an Escherichia coli selection marker and an E. coli origin of replication. The expression vector is transformed into the fungal host cell and the expression vector is integrated into the chromosome of the host cell, typically in more copies by tandem integration into one locus [21, 22]. An ideal integration of two copies is illustrated in Fig. 4.3. Typically the expression vectors are constructed in Escherichia coli, and so elements necessary for this are often present in the final expression vector. The most widely used selection marker in E. coli is the beta lactamase gene giving resistance to penicillins such as ampicillin. Public concern about the spreading of antibiotic resistance markers has drawn attention to this part of the expression construct even though antibiotic resistance markers from GMMs used in contained production cannot be found in nature, even when the biomass is spread to surrounding fields [23]. So antibiotic markers have been replaced by other markers such as auxotrophic markers by most enzyme producers, and often the E. coli parts of the expression vector are completely removed before transforming the construct into the host strain. The selection marker for selection of the expression vector in the fungus is very important, because different selection markers results in a different range of copy numbers of integrated expression vector copies. The pyrG gene is sometimes used

101

102

4.3 Design of Genetically Modified Microorganisms for Production Terminator

Product gene Selection marker Expression plasmid Promoter

Host Genome

GMM genome

Fig. 4.3 Integration of an expression plasmid into the genome. Tandem integration of an expression plasmid featuring a promoter, a product gene, a terminator, and a selection

marker into the genome of a filamentous fungus is illustrated. The integration shown is a head-to-tail integration in one locus with no further recombination.

for selection expression vector, typically when the strategy is to insert the heterologous gene into a particular locus. This locus could be the amyloglycosidase locus of Aspergillus awamori. The pyrG marker can also be used when the strategy is to remove the marker by recombination in a step after the transformation step, in very much the same way as described for the gene disruption [24]. The drawback of these strategies is that typically only one copy of the expression vector is integrated into the genome, giving low production yields. The amdS (acetamidase) gene of Aspergillus nidulans [25] is often used as selection marker in Aspergilli and even in other fungi. The selection principle is that the acetamide gene enables transformed cells to hydrolyze acetamide, and on hydrolysis to use the ammonium formed as the sole source of nitrogen or the acetate formed as the sole source of carbon. The advantage of this marker is that both in Aspergillus oryzae and in Aspergillus niger high copy numbers are obtained, and thus high fermentation yields in production. The choice of promoter is crucial for the yields and it is one of the elements that has been most extensively studied and developed. For expression in Aspergillus the amylase promoters were the natural choice as starting points for promoter development. These are very strong promoters and their regulation is convenient in a production set-up, because they are induced by starch, maltodextrins and maltose. One of their drawbacks is that they are carbon-catabolite-repressed, which puts a restraint on production. To avoid low productivity, the feed rate in batch-fed or in continuous fermentation must be carefully controlled. The Aspergillus amylase promoters are regulated very much in the same way, and they have been shown to be activated by the same activator [26].

4 Production of Food Additives Using Filamentous Fungi

The TAKA amylase is a very well expressed amylase in Aspergillus oryzae, so the TAKA amylase promoter is one of the broadly used Aspergillus amylase promoters [8]. The neutral amylase promoter from Aspergillus niger is highly hom*ologous with the TAKA promoter from Aspergillus oryzae and is, likewise, widely used [27]. These two promoters share sufficient sequence similarity to enable establishment of analytical methods that will detect both. The amyloglycosidase promoter from Aspergillus niger or Aspergillus awamori is in the same range of promoter strength. The sequence is quite distant from the sequence of the TAKA and the neutral amylase promoters but is regulated by the same activator. The amyloglycosidase promoter is also widely used [9]. The choice of terminator is not as critical as the choice of promoter. In Aspergillus the amyloglycosidase terminator from Aspegillus niger is widely used [8]. The expression vectors for Trichoderma reesei are somewhat different from the Aspergillus expression vectors. The most frequently used promoter is the cellobiohydrolase I promoter or variants of this [28]. This promoter is, like sophorose, induced by cellulose but also by more readily available carbon sources. This promoter is also carbon-catabolite-repressed, but promoter variants in which the creA sites mediating this repression have been removed have been described [29]. Several different selection markers are used in Trichorderma. These are often dominant selection markers against drugs, for example the hygromycin or bleomycin resistance markers. A variety of yeast systems have also been developed for production of enzymes, for example Klyveromyces lactis, Hansenula polymorpha, and Pichia pastoris [30]. One notable difference between yeast systems and filamentous fungal systems is that most of the yeasts have self replicating plasmids, i.e. the transforming DNA is not necessarily integrated into the genome of the host strain. Genetic stability using self replicating plasmids is significantly lower that the stability of strains in which the DNA has been chromosomally integrated, so integrating expression vectors are preferred in yeasts also. Host strain development is achieved in very much the same way as for the filamentous fungi. Proteases, especially, are removed by gene disruption. The methylotrophic yeasts Hansenula polymorpha and Pichia pastoris produce large amounts of alcohol-utilization genes when induced by methanol. All or some of these genes have been disrupted in some host strains, or the expression plasmid is integrated into one of these genes when making the final GMM, thereby disrupting the gene. The promoters used to drive expression in the methylotrophic yeasts are typically promoters from the alcohol utilization genes, for example the alcohol oxidase 1 or formate dehydrogenase promoter in Pichia pastoris, or the methanol oxidase 1 or formate dehydrogenase promoter in Hansenula polymorpha. In Klyveromyces lactis the beta galactosidase promoter (LAC4) has been identified as a strong promoter. For all of the yeast systems several different selection markers, including both dominant and auxotrophic markers, have been developed. The URA3 marker, the yeast hom*olog of pyrG is very often used. The choice of design for the GMM is not only determined by strictly technical criteria, for example high yield and high product purity. Legal requirements and

103

104

4.3 Design of Genetically Modified Microorganisms for Production

product-approval procedures also play a major role when deciding on the design. As already mentioned, antibiotic resistance markers are usually avoided because of public concern and probably because of the expectation that constructs containing antibiotic resistance markers may be banned eventually. Another design that has gained increasing importance in some regions, for example Europe and Japan, is the so called “self cloning” concept. The definition of “self cloning” varies between regions. In the EU the definition is given in EU Directive 98/81/EC, and reads: “Self-cloning consisting in the removal of nucleic acid sequences from a cell of an organism which may or may not be followed by reinsertion of all or part of that nucleic acid (or synthetic equivalent) with or without prior enzymatic or mechanical steps, into cells of the same species or into cells of phylogenetically closely related species, which can exchange genetic material by natural physiological processes, where the resulting microorganism is unlikely to cause disease to humans, animals or plants. Selfcloning may include the use of recombinant vectors with an extended history of safe use in the particular microorganism.” There are advantages to the producer if a GMM can be assessed as being “selfcloned”. Product and production approval process may be faster and less demanding of resources and the legal status of GMM varies from country to country. In some countries, e.g. Germany, Finland, and Austria, a “self-cloned” GMM is not regarded as a recombinant organism. This may have a major effect on labeling requirements, depending on future EU regulations. Genetic manipulations for metabolites are very much of the same type as the manipulations described for enzyme production. The main tools in metabolic engineering are gene disruption, gene replacement, and overexpression of genes, for example by increasing the copy number or introduction of new genes. Gene replacement is a variant of gene disruption. The result of gene replacement is that a target gene is replaced with another gene, typically in a two-step strategy very similar to the gene disruption strategy previously described. The real challenge in metabolic engineering is to qualify suggestions for genetic changes and to develop models that can predict the outcome of these genetic changes. The number of genes is huge and the metabolic network is simply too complex to rely on “simple” predictions or a “trial and error” approach. Development of mathematical modeling tools combined with post-genomic experimental methods, for example transcriptomics, proteomics, and metabolomics, have evolved into a new scientific discipline known as “systems biology” [31]. A prerequisite for a “systems biology” approach to improving either enzyme or metabolite production of an organism is that the genome of the organism has been sequenced and sufficiently annotated. The genome sequences of the fungal systems used for enzyme or metabolism production have either just been made available or will be made available in a short time. Annotation of these genome sequences is still not complete and will remain scarce for years to come. So although systems biology is well implemented for the yeast Saccharomyces cerevisiae [32] it is

4 Production of Food Additives Using Filamentous Fungi

in its infancy for filamentous fungi. Despite the lack of well annotated sequence data, experimental work to improve Aspergillus systems using DNA array technology has been initiated [33] and systems biology approaches to improve protein production have been reported [34]. Systems biology is likely to enable production of new metabolites in fungi or to significantly improve the production strains for existing metabolites and improve the capacity for enzyme production.

4.4 Industrial Enzyme Production Processes

Nearly all industrial enzyme products are formulations of enzymes secreted from the fungus during fermentation. After the fermentation the fungal biomass is removed and the enzyme is recovered from the broth. Because the GMM DNA is present in the biomass, the DNA is removed with the biomass. So only GMM DNA released to the broth as a result of cell lysis, and which is not removed or degraded during the subsequent recovery and formulation processes, is present in the final product. This means that the utility of analysis of the final product for GMM based on the recombinant DNA will be totally dependent on the production process. A brief introduction to industrial fermentation processes is therefore given here. Traditionally, enzyme production using filamentous fungi has been based both on surface fermentation and on submerged fermentation processes. Today enzymes are produced almost exclusively by submerged fermentation processes. Fermentation processes to produce industrial enzymes using recombinant fungi start with inoculation of a small flask containing an agar medium with a vial of the GMM. The flask is placed in an incubator which provides the optimum temperature for the culture to sporulate. The spores are transferred to a seed fermenter – a small fermenter in which the biomass for the main fermentation is generated. The seed fermentation enables the cells to adapt to the environment and nutrients they will encounter later. After seed fermentation the cells are transferred to the main fermenter, where temperature, pH, and dissolved oxygen are carefully controlled to optimize enzyme production. The fermentation process can either be run as a batch process, a fed-batch process, or a continuous fermentation. In the batch process all media components are added at the start of the fermentation. In fed-batch fermentation the fungus is fed with additional medium during the fermentation. In continuous fermentation a steady state is reached by simultaneously supplying fresh medium and harvesting from the tank. The extent of cell lysis during fermentation is mainly dependent on the GMM that is fermented, the duration of the fermentation process, and the design of the fermenter (i.e. the shear stress the biomass will encounter). A typical fermentation process is outlined in Fig. 4.4. When the main fermentation is complete the mixture of cells, nutrients, and enzymes, referred to as the broth, is ready for filtration, recovery, and purification – collectively referred to as downstream processing.

105

106

4.4 Industrial Enzyme Production Processes Water

Raw materials

Mixing of nutrient medium

Carbohydrates:

Exhaust

Ground grain/corn Starch Glucose Sugar

Sterilization

Cooling water Proteins: Soy bean meal Gluten Corn steep liquor Casein Salts: Phosphates Sulfates Ammonium salts

Inoculation flask

Seed fermenter Air Compressor

Fig. 4.4 Outline of a fermentation process. A typical process flow is demonstrated. Spores from an inoculation flask are used to inoculate a seed fermenter, and this in turn is used to inoculate the main fermenter.

Fermenter

Pretreatment Filter aid is added

Culture broth

Sterile filter

Fermented broth for recovery of enzyme

The fermenter can be aerated, and large propellers in the fermenter stir the fermentation broth. Additional medium components can be prepared and added during fermentation.

Preservatives are added

Bacterial filtration

Ultrafiltration Stabilization

Salt is added

Cooling

Liquid product

Liquid concentrate for granulation

A B

Drum filtration

Bacterial filtration

Fig. 4.5 Outline of a recovery process. Typical process flows are shown. The biomass is separated from the broth by filtration.

Enzyme crystals for granulation Filtration of enzyme crystals

The broth is then concentrated and sterile filtered. Alternatively the enzyme is recovered by crystallization.

4 Production of Food Additives Using Filamentous Fungi

First, the broth containing the enzyme is separated from the biomass. This is achieved by various chemical treatments of the fermentation broth to ensure efficient separation, followed by removal of the biomass using either centrifugation or filtration. After the separation the enzyme is concentrated by means of semipermeable membranes or evaporation. For products with high purity demands, the downstream process often requires special steps to remove unwanted impurities. This is often done by selective precipitation or adsorption of the impurities or by crystallization, by which very pure enzyme products can be obtained. In rare cases costly column chromatography may be used. The recovery process is outlined in Fig. 4.5. The final step in the process is formulation of the enzyme product. The enzymes can be formulated either as liquid products or as granulates, depending on the application of the enzyme. The critical issues of the formulation are to secure stability of the enzyme product, release of the enzyme in the application, and prevention of enzyme dust formation that can cause allergy.

References 1 G. Gellissen, K. Melber, Z. A. Janowicz, U. M. Dahlems, U. Weydemann, M. Piontek, A. W. Strasser, C. P. Hollenberg, Antonie Van Leeuwenhoek. 1992, 62, 79–93. 2 C. K. Raymond, T. Bukowski, S. D. Holderman, A. F. Ching, E. Vanaja, M. R. Stamm, Yeast. 1998, 14, 11–23. 3 A. P. J. Trinci, Mycol. Res. 1992, 96, 1–13. 4 J. W. Bennet, SIM news, 2001, 51, 65–71. 5 J. W. Bennet, M. A. Klich. Aspergillus, Biology and industrial applications. Butterworth–Heinemann, Stoneham, USA, 1992. 6 P. Barbesgaard, H. P. Heldt-Hansen, B. Diderichsen, Appl Microbiol Biotechnol 1992 36, 569–72. 7 S. D. Martinelli, J. R. Kinghorn, Aspergillus: 50 years on, Progress in industrial microbiology vol 29, Elsevier, Amsterdam. 8 T. Christensen, H. Woeldike, E. Boel, S. B. Mortensen, K. Hjortshoej, L. Thim, M. T. Hansen, Biotechnology. 1988, 6, 1419–1422. 9 R. M. Berka, K.H. Kodama, M. W. Rey, L. J. Wilson, M. Ward, Biochem Soc Trans. 1991, 19,681–685. 10 S. Keränen, M. Pentillä, Curr. Opinion in Biotech. 1995, 6, 534–537.

11 J. C. Royer, D. L. Moyer, S. G. Reiwitch, M. S. Madden, E. B. Jensen, S. H. Brown, C. C. Yonker, J. A. Johnston, E. J. Golightly, W. T. Yoder, Biotechnology. 1995, 13,1479–1483. 12 B. Christensen, J. Nielsen, Adv Biochem Eng Biotechnol, 2000, 66, 209–231. 13 H. Pedersen, B. Christensen, C. Hjort, J. Nielsen, Metab Eng. 2000, 2, 34–41. 14 T. Hoshino, K. Ojima, Y Setoguchi, Hoffmann la Roche and Co AG, Roche vitamins inc. European patent EP-0108210, 1998. 15 J. Lehmbeck, Novo Nordisk A/S, European patent EP-0956338-A1, 1996. 16 D. J. Ballance, G. Turner, Gene, 1985, 321–331 17 J. Sambrook, E. F. Fritsch, T. Maniatis, Molecular cloning, a laboratory manual, second edition, Cold Spring Harbor Laboratory Press 1989. 18 S. E. Unkles, E. I. Campbell, D. Carrez, C. Grieve, R. Contreras, W. Fierss, C. A. M. J. J. van den Hondel, J. R. Kinghorn, Mol. Gen. Genet., 1989, 218, 99–104 19 J. C. Royer, L. M. Christianson, W. T. Yoder, G. A. Gambetta, A. V. Klotz, C. L. Morris, H. Brody, S. Otani, Fungal Genet Biol, 1999, 28, 68–78.

107

108

References 20 C. Hjort, A. M. J. J. van den Hondel, P. Punt, F. H. J. Schuren, Novo Nordisk A/S Patent WO 0020596, 1998. 21 J. R. Fincham, Microbiol Rev, 1989, 53, 148–170. 22 B. Ruiz-Díez, J Appl Microbiol, 2002, 92, 189–195. 23 J. T. Andersen, T. Schäefer, P. L. Joergensen, S. Moeller, Res Microbiol, 2001, 152, 823–833. 24 G. C. M. Selten, R. F. M. van Gorcom, B. W. Swinkels, Gist Brocades NV, European patent EP 0635574A1. 25 C. M. Corrick, A. P. Twomey, M. J. Hynes, Gene, 1987, 63–71. 26 K. L. Petersen, J. Lehmbeck, T. Christensen, Mol Gen Genet, 1999, 262, 668–676. 27 E. Boel, T. Christensen, H. F. Woeldike, Novo Nordisk A/S, European patent EP0238023, 1987.

28 J. M. Uusitalo, K. M. Nevalainen, A. M. Harkki, J. K. Knowles, M. E. Penttilä, J. Biotech.,1991, 17, 35–49. 29 M. Ilmén, M. L. Onnela, S. Klemsdal, S. Keränen, M. Penttilä, Mol Gen Genet, 1996, 253, 303–314. 30 G. Gellissen, C. P. Hollenberg, Gene, 1997, 190, 87–97. 31 D.B. Kell, M. Brown, H. M. Davey, W. B. Dunn, I Spasic, S. G. Oliver, Nature Reviews Microbiology, 2005, 3, 557–565. 32 J. Nielsen. FEMS Yeast Res.,2004, 4, 757–758. 33 A. H. Sims, M. E. Gent, K. Lanthaler, N. S. Dunn-Coleman, S. G. Oliver, G. D. Robson, 2005, Appl. Environ. Microbiol., 71, 2737–2747 34 K. R. Patil, J. Nielsen, PNAS, 2005, 102, 2685–2689

5 Genetic Engineering of Bacteria Used in Food Fermentation Arnold Geis

5.1 Introduction

Fermentation is very old technology used for food production in many parts of the world. Indigenous fermented foods, for example fermented milk products (e.g. cheeses), bread, fish, meat, and numerous vegetables and fruits have been prepared for thousands of years and are often strongly linked to tradition and culture. Production of fermented foods involves the use of microorganisms (and/or enzymes) which alters such properties of the raw material as taste, texture, digestibility, nutritional value, and shelf-life. Fermentation is a relatively efficient, low-energy preservation process and is, therefore, an appropriate technique for safe food production in developing countries with little or no access to sophisticated techniques for food preservation. In these countries a great variety of raw materials, mainly of plant origin, have been fermented. Fermentation is usually performed in spontaneous processes under non-aseptic conditions. The specific environment then gradually selects for those microorganisms required for the desired product. The underlying microbial and/or enzymatic processes are usually poorly understood, which makes the process difficult to control. Any refinement and up-scaling of the fermentation processes needs better understanding of the microorganisms involved and their metabolic capabilities. Such knowledge would enable the selection or development of more productive bacterial cultures and a better control and manipulation of the culture conditions. This, with improved fermentation technology, would have a large impact on nutrition and food safety in developing countries while reducing post-harvest losses. In developed countries, mainly located in the northern hemisphere with modest climate, milk – and to a lesser extent meat, fish, and vegetables – form the raw material for the production of fermented foods. During the long history of fermentation – especially of milk – sophisticated technology has been developed, and well-characterized fermentation cultures now enable the controlled, large-scale production of many safe, tasty products with high nutritional value. For example,

110

5.2 Lactic Acid Bacteria

approximately 13 × 106 tons of cheese were consumed in the USA and the EU in 2001. In addition to efforts to improve the production of traditional fermented milk products, in recent years an increasing amount of scientific effort has been devoted to developing new products with additional beneficial effects on the health of the consumer (these are termed “functional foods”). Products fermented with or containing added probiotic bacteria are thought to relieve lactose intolerance, reduce the duration of rotavirus-induced diarrhea, and to alleviate allergic reactions. Other proposed beneficial health effects of probiotics await confirmation. Likewise, many of the mechanisms behind these health-promoting effects must be elucidated by in-vitro and in-vivo studies. In addition to yeasts and filamentous fungi (Chapter 3) lactic acid bacteria (LAB) play a dominant role in food fermentation, causing characteristic changes in, and prolonging the shelf-life of, fermented food. LAB that grow during fermentation either originate from the raw material (plant material, meat) or are added as starter cultures (milk, meat). LAB used in food fermentation are generally regarded as safe or even advantageous for human health (probiotics).

5.2 Lactic Acid Bacteria

The lactic acid bacteria form a heterogeneous group of Gram-positive bacteria, but are physiologically related by their ability to ferment carbohydrates to lactic acid as the predominant metabolic end-product. hom*ofermentative LAB convert fermentable carbohydrates almost quantitatively into lactic acid whereas heterofermentative LAB produce lactic acid and other compounds, for example acetic acid, CO2, and ethanol as primary metabolic end products. Some LAB also produce flavor compounds that are essential to the final taste of the fermented product. Species from six genera of lactic acid bacteria have been used in industrial production of food, feed, and alcoholic beverages (Table 5.1). 5.2.1 Lactococcus lactis subsp. lactis and subsp. cremoris

Lactococci are mesophilic, hom*ofermentative LAB which are used extensively in milk fermentation to produce a large number of different products. Lactococcus lactis is the best characterized LAB with regard to its physiology and molecular genetics. Determination of the complete nucleotide sequence of L. lactis subsp. lactis IL1403 (Bolotin et al., 1999, 2001) and L. lactis subsp. cremoris strains MG1363 and SK11 (Table 5.2) makes these bacteria amenable to transcriptome and proteome analysis and enables comparative and functional genetic analysis among lactococci (Kok et al. 2005). During the past two decades, a plethora of methods and molecular devices has been developed to perform almost any kind of genetic engineering of these bacteria. (see below and Chapter 12).

5 Genetic Engineering of Bacteria Used in Food Fermentation Tab. 5.1 Lactic acid bacteria used for food fermentation. Dairy products (butter and buttermilk, yogurt and cheeses) Lactococcus lactis subsp. lactis L. lactis subsp. lactis var. diacetylactis L. lactis subsp. cremoris Lactobacillus delbrueckii subsp. bulgaricus Lb. casei Lb. helveticus Lb. acidophilus Leuconostoc mesenteroides subsp. cremoris Ln. lactis Streptococcus thermophilus Meat and fish products (fermented sausages, many indigenous products) Lactobacillus curvatus Lb. sake Lb. plantarum Pediococcus acidilactici P. pentosaceus various undefined LAB Plant products (sauerkraut, olives, cassava products, soy sauce, and many indigenous products) Lactobacillus plantarum Lactobacillus ssp. Leuconostoc mesenteroides Pediococcus pentosaceus various undefined LAB Bakery products (sourdough products, cracker) Lactobacillus sanfrancisco Lb. plantarum Lb. fermentum Lb. reuteri, Lb. amylolyticus Lb. ssp.

5.2.2 Lactobacillus spp.

The genus Lactobacillus comprises a large number of relatively diverse species. Lactobacilli are widespread in nature, and many have been used in food-fermentation processes, including fermentation of milk, meat, and plant material. In addition, a few species of Lactobacillus are used as probiotic microorganisms in functional foods (Table 5.1). Lactobacilli have been divided approximately into three groups that reflect mainly their abilities to ferment the different hexoses, pentoses, and di-

111

112

5.2 Lactic Acid Bacteria Tab. 5.2 Genome sequences of lactic acid and related bacteria used in food biotechnology. Organism name

Strain

Status

Genome size (Mb)

Reference and/or accession number

Lb. brevis

ATCC367

IP[*]

1,88

JGI[**]

Lb. casei

ATCC334

2,76

JGI/AAGR00000000

Lb. delbrueckii subsp. bulgaricus

ATCC BAA-365

1.63

JGI/AAGQ00000000

ATCC11842

ATCC33323

Lb. gasseri

Genoscope/CR954253

[***]

1.95

JGI/AAAO00000000

2.0

Altermann et al. 2003 CP000033

Lactobacillus acidophilus

NCFM

Lb. johnsonii

NCC 533

1.99

Pridmore et al. 2004/ AE017198

Lb. plantarum

WCFS1

3.3

Kleerebezem et al. 2003 AL935263

Lb. reuteri

JMC1112 100-23

IP IP

JGI/AAOV00000000 JGI/AAPZ00000000

Lb. sakei

23K

Dudez et al. 2002/ CR936503

Lactococcus lactis subsp. lactis

IL1403

2.3

Bolotin et al. 2001/ AE005176

L. lactis subsp. cremoris

SK11

2.3

JGI/AAGO00000000

L. lactis subsp. cremoris

MG1363

2.6

unpublished

Leuconostoc mesenteroides ATCC8293 subsp. mesenteroides

2.13

JGI/AABH00000000

Leuconostoc citreum

KM20

Oenococcus oeni

MCW PSU-1

O. oeni

IOB 8413

Pediococcus pentosaceus

ATCC25745

2.0

JGI/AAEV00000000

Streptococcus thermophilus

CNRZ1066

1.8

Bolotin et al. 2004/ CP000024

S. thermophilus

LMG18311

1.8

CP000023

S. thermophilus

LMD9

1.7

JGI/AAGS00000000

* ** ***

IP, in progress JGI, Joint Genome Institute (www.jgi.doe.gov) F, finished

Korean Res. Inst. Biosci. Biotech. 1.78

JGI/AABJ00000000 unpublished

5 Genetic Engineering of Bacteria Used in Food Fermentation

saccharides to lactic acid or lactic acid and other metabolites (Hammes and Vogel, 1995; Axelsson, 1998). Currently (july 2006) determination of the genome sequences of eleven lactobacilli species has been completed (Table 5.2). For those species for which complete genomes are annotated and published a diverse picture emerges of conserved and varying biosynthetic and metabolic capabilities (Klaenhammer et al. 2005) On the basis of genome sequence the biochemical and genetic analysis of these bacteria, which is still rudimentary for many of the species, will further accelerate and enable better and extended exploitation of this important bacterial group for both traditional and new purposes. Comparative genetics of probiotic and nonprobiotic species may help to identify the genetic and biochemical determinants responsible for the health-promoting effects of probiotic lactobacilli. 5.2.3 Streptococcus thermophilus

S. thermophilus is the only streptococcal species used with Lactobacillus spp. as starter culture in food technology for the manufacture of yogurt, mozarella, and Swiss-type cheeses. It is distinguished from the other streptococci by its ability to grow at elevated temperatures (up to 52°C), and its limited ability to ferment sugars. The increasing manufacture of the above-mentioned products demands deeper understanding of the performance and production requirements of such starter cultures. The number of industrial strains which comply with these demands is limited. Several traits such as phage resistance and exopolymer synthesis have been targets for strain improvement programs (Delcour et al., 2000). The availability of the complete genome sequences of three S. thermophilus strains (Table 5.2) has strongly improved knowledge of the metabolism and the molecular genetics of this species (Hols et al. 2005). This will facilitate selection of appropriate strains for the food industry and for genetic engineering to develop new strains with improved or novel properties which may, e.g., enable better control of the large-scale fermentation processes currently used. 5.2.4 Leuconastoc spp.

Bacteria of the genus Leuconostoc have been found in many natural and man-made habitats. Numerous strains have been isolated from grass, herbage, and silage (Garvie, 1960; Whittenbury, 1966). These heterofermentative bacteria play an essential role in the fermentation of vegetables such as cabbage and cucumbers, where they initiate spontaneous lactic acid fermentation (Peterson, 1960; Daeschel, 1987). The ability of some species (especially Ln. mesenteroides subsp. cremoris) to ferment the citric acid of the milk to the flavor compound diacetyl has led to their use in dairy starter cultures for this purpose (Sandine and Elliker, 1970, Cogan and Jordan, 1994; Vedamuthu, 1994). The ability of Ln. mesnenteroides subsp. mesenteroides to produce dextrans and levans has been exploited for industrial production of these

113

114

5.2 Lactic Acid Bacteria

substances for use in the biochemical and pharmaceutical industries (Sutherland, 1996). Determination of the genome sequences of Ln. mesenteroides subsp. mesenteroides and Ln. citreus are still in progress (Table 5.2). 5.2.5 Pediococcus spp.

Members of the genus Pediococcus are hom*ofermentative, acidophilic bacteria that divide alternately in two perpendicular directions to form tetrads (Simpson and Taguchi, 1995). Several species, for example P. pentosaceus and P. acidilactici, are used as starter cultures for sausage making, fermentation of vegetables and soy milk, and for silage inoculation (Hammes, 1990, Simpson and Taguchi, 1995) and are also found on ripening cheeses as constituents of nonstarter lactic acid microflora (Fox et al., 1990). P. pentosaceus strains may contain up to five plasmids linked to the ability to ferment raffinose, melibiose, and sucrose and to produce bacteriocins (Daeschel and Klaenhammer, 1985, Gonzales and McKay, 1986). Determination of the genome sequence of P. pentosaceum ATCC25745 has recently been finished and is publicly available (Table 5.2). This will make this organism an interesting subject for genetic and functional studies and for metabolic and genetic improvements of industrial strains. 5.2.6 Oenococcus spp.

Oenococcus oeni (formerly Leuconostoc oenos) is a highly acid and alcohol-tolerant lactic acid bacterium found naturally in fruit mashes and related habitats (Dicks et al. 1995). The most studied aspect of O. oeni is its ability to convert malate into lactate. This malolactic conversion is employed in wineries to reduce the acidity of high-acid wines and to improve the stability and quality of wines (Kunkie, 1991; Versari et al. 1999; Alexandre et al. 2004). Determination of the genome sequence of two commercially used O. oeni strains – PSU-1 and IOEB8413 – has been achieved and the O. oeni PSU-1 sequence is publicly accessible in a draft version (Acc. No. AABJ00000000). Knowledge of the O. oeni genome will be valuable for the development of new tools to control malolactic fermentation in wine (Mills et al. 2005).

5 Genetic Engineering of Bacteria Used in Food Fermentation

5.3 Perspectives and Objectives 5.3.1 Bioconservation

Preservation of food by drying, salting, and fermentation are traditional methods of food preservation. The industrialization of food processing had increased the need for and use of chemical additives to prolong shelf-live and prevent or reduce the deleterious effects of contamination by spoiling microorganisms. The growing demand of the consumer for more natural food and an awareness of the health risks of some chemical food preservatives has led to a demand for alternatives. The preservation of food by antagonistic microorganisms has been well known for many decades (Hurst, 1973) but has not yet been applied to food preservation on a large scale. The term “bioconservation” was coined to distinguish this type of preservation from the chemical preservation of foods. Bioconservation may consist of adding bacterial strains that produce antagonistic compounds or by adding the purified antagonistic substances. Some LAB produce, in addition to their main metabolic products, a variety of inhibitory substances, for example diacetyl, CO2, hydrogen peroxide and bacteriocins. Bacteriocins – proteinaceous compounds that inhibit the growth of closely related bacteria – are produced by a variety of lactococcal strains. In a survey of 280 strains isolated from dairy environments, 5% were found to produce such substances. On the basis of biochemical and physical properties, host range, and cross-reactivity eight bacteriocin types were predicted (Geis et al., 1983, Klaenhammer, 1993). In recent years several of these bacteriocins have been characterized by genetic and biochemical methods and assigned to two main classes: lantibiotics – class I – and small, heat stable nonlantibiotics – class II (Nes et al., 1996). Although most of the bacteriocins of LAB have a narrow host range and are effective only against closely related bacteria, some are active against a broad spectrum of Gram-positive bacteria, including food pathogens (e.g. Listeria spp., Clostridia spp.). Bacteriocins of the latter group have the greatest potential for use as food preservatives. Nisin, a lantibiotic, is the best known bacteriocin and the only one approved for biopreservation of food. It is produced by some L. lactis strains and has a broad antibacterial spectrum. Nisin is used as a protective agent in a variety of food products worldwide (a review has been published by Vandenbergh, 1993). Nisin is most effective in acidic environments, however, and consequently its use is limited. Lacticin 3147 is a two-component bacteriocin produced by Lactococcus lactis DPC 3147 (Ryan et al. 1996) and inhibits the growth of a variety of Gram-positive bacteria, including food pathogens such as Listeria monocytogenes, Clostridia, Staphylococci, and Streptococci. It can be used for food protection when delivered either as a food ingredient or through the action of a bacteriocin-producing starter. Lacticin 3147 is encoded on a conjugative plasmid and can easily be transferred, by conjugation, into industrially used starter strains. The effectiveness of this bacteriocin has been proven in cheese manufacture and ripening and even in mastitis control.

115

116

5.3 Perspectives and Objectives

Because of its broad pH range, Lacticin 3147 has an advantage over nisin as a food preservative and may even be used for prevention of dental caries and for treatment of acne (Ross et al. 2002; O’Sullivan et al. 2003, Guanine et al. 2005). A steadily increasing number of bacteriocins produced by different genera of LAB are currently under investigation by a variety of genetic and biochemical means. Some of these compounds show promise for potential use as food preservatives. Many of the bacteriocins can be expressed in heterologous hosts, and this may extend their application in food preservation (Rodriguez et al. 2002). Better knowledge of the genetics and biochemistry of these substances may, in future, enable the design of tailor-made bacteriocins by site-directed mutagenesis with improved stability, pH range, and activity spectrum. Placing a bacteriocin gene or operon under the control of a growth-phase, pH, or salt-dependent promoter might enable secretion of the protective substance on completion of the fermentation process, without having any detrimental effects on the starter and/or the ripening culture. The construction of multi-bacteriocinic strains by recombinant gene technological methods may further extend the usefulness of these compounds in food preservation. 5.3.2 Bacteriophage Resistance

Bacteriophage infection during fermentation, especially in the dairy industry and in other submerged fermentations (e.g. acetic acid) is a ever-present danger that can lead to significant economic losses. Thus, bacteriophage resistance of fermentation cultures is a property of great importance which has attracted extensive scientific interest. Most of these investigations have been – and still are – concentrated mainly on lactococci and, very recently, on other LAB. In general, bacteria have a variety of phage-defense systems that interfere with all steps of phage development – from phage adsorption to DNA injection and replication, expression of the phage genes, and assembly and maturing of the phage particle. Research into phage-resistance mechanisms of dairy starter strains and, especially, of lactococci, has been summarized recently in several comprehensive reviews (Klaenhammer, 1987; Hill, 1993; Forde and Fitzgerald, 1999; Coffey and Ross, 2002; Josephsen and Neve, 2004). In lactococci, the phage-defense systems are predominately encoded on plasmids, many of which are self-transmissible, and this affords the opportunity to transfer phage-resistance genes to other, industrially important strains by conjugation, a natural (food-grade) gene-transfer mechanism. Conjugation has been successfully used to create starters that perform reliable dairy fermentations. Genetic linkage of phage-defense systems with bacteriocin production and resistance and/or immunity genes as selection marker on lactococcal plasmids has been used for strain construction. Three different, potent phage-resistance mechanisms encoded on different plasmids were introduced to a recipient strain by sequential transfer. The resulting strain was highly phage-resistant and successfully used for cheese manufacture (O’Sullivan et al., 1998). The use of this method for strain construction is limited by the lack of dominant selection markers and often by instability of the

5 Genetic Engineering of Bacteria Used in Food Fermentation

transferred plasmids, although this may be because of incompatibility of the transferred plasmid with the indigenous plasmids of the recipient. In addition, many phage-resistance systems reside on nonconjugative plasmids. More than 50 different phage-defense systems, including abortive infection (Abi), restriction-modification (R/M) systems, and some others, all of which act on other stages of phage propagation, have been identified in lactococci. The number of these systems identified in other LAB has also increased steadily (Josephsen and Neve, 2004; Chopin et al. 2005). The genome-sequencing program currently being performed on LAB will further extend our knowledge about phage resistance in all members of this bacterial group. New tools of recombinant DNA technology and the growing number of suitable gene cloning systems (see below) will enable improvements to be made in the phage resistance of industrially used starter strains. In principle any combination of phage-defense systems acting on different stages of phage development and/ or on different phages could be transferred in many industrial strains by use of electrotransformation or sophisticated conjugation methods (Hickey et al. 2001). So far, the use of recombinant DNA technology to improve starter bacteria is limited by legislative constraints, although the development of food-grade gene-delivery systems may overcome these limitations. Vectors with bacteriocin resistance and/or immunity genes as selection marker are available, as also are other systems based on complementation (Sørensen, 2000). A two component food-grade cloning system was developed recently; it consists of a vector entirely made up of L. lactis DNA without any selection marker and a replication-deficient plasmid encoding a selectable marker gene that depends on the presence of the vector plasmid for maintenance. After cloning of the desired gene into the vector both plasmids were transferred to the host strain by co-electroporation. Under selective conditions only cells which contain both plasmids can grow. Because of intrinsic incompatibility the plasmid carrying the selection marker is easily lost from the cells during growth under nonselective conditions. In this way, a phage-defense system (AbiQ) was stably introduced into two industrial strains, resulting in an effective resistance phenotype against phages (Emond et al. 2001). An efficient recombinant anti-phage system, denoted PER (phage-encoded resistance) was first described by Hill et al. (1990). It is based on the observation that the lytic cycle of a phage can be interrupted by presenting the origin of replication (ori) of the phage in multiple copies in the host cell. After infection, the phage replication factors are titrated by the multi-copy ori present on a plasmid vector. This results in induction of the plasmid rather than replication of phage DNA. By cloning multiple copies of the phage ori increased efficiency of the PER phenotype was achieved (McGrath et al. 1999, 2001). Antisense RNA technology also has been used to construct phage-resistant strains. Transcription of the noncoding strand of phage genes results in nontranslatable RNA hybrids, which are rapidly degraded. The reduction of transcripts for essential phage components severely disturbs propagation of the phage (Kim and Batt, 1991). Several antisense RNA cassettes have been developed and used in combination with inducible promoters, explosive expression vectors, and phage

117

118

5.3 Perspectives and Objectives

triggered suicide traps (O’Sullivan et al., 1996; Djordjevic et al. 1997; Sturino and Klaenhammer, 2002). The suicide system makes use of phage-inducible promoters and a gene lethal to the host cell. Introduction of these constructs to L. lactis and S. thermophilus strains resulted in significant protection against phage attack. These approaches, in combination with the food-grade, two-component genedelivery system and the availability of genome sequence data, will provide new opportunities to construct highly phage-resistant, food-grade starter strains. 5.3.3 Exopolysaccharides

Polysaccharides, which form a very diverse group of polymers, have been used for many purposes in industry. High-molecular-weight exopolysaccharides (EPS) are important ingredients in many food products as thickeners, stabilizers, emulsifiers, fat replacers, or gelling agents. Most of these polysaccharides have been derived from plant material, but alternative sources of these compounds include bacteria. For food manufacture, EPS produced by lactic acid bacteria are of major importance to the texture and organoleptic properties of many fermented milk products. Health benefits have also been attributed to some EPSs, for example immunomodulating and antitumor activity (Zubilla et al. 2001; Chabot et al. 2001; Ruas-Madiedo et al. 2002; Welman and Maddox, 2003). The EPSs of LAB form a very diverse group with regard to chemical composition, size, molecular structure, and physicochemical properties (De Vuyst and Degeest, 1999, 2001; Vaningelgem et al. 2004). The genetic determinants for EPS synthesis in Lactococcus lactis (van Kranenburg et al. 1997), Streptococcus thermophilus (Stingele et al. 1996; AlmironRoig et al. 2000; Germond et al. 2001), Lactobacillus delbrueckii subsp bulgaricus (Lamothe et al. 2002), and Lactobacillus rhamnosus (Van Calsteren et al. 2002; Peant et al. 2005) have been sequenced and analyzed and reveal a common operon structure, which suggests a common biosynthesis mechanism (for a review, see Jolly and Stingele, 2001). The gene sequence in all EPS-biosynthesis clusters is: regulation, chain-length determination, biosynthesis of the repeating unit, polymerization, and export (Jolly et al. 2002). Although structure–function relationships of EPS and interaction of specific EPS with different food components are poorly understood, clarification of these is an ongoing objective of much scientific effort. A better knowledge of these relationships combined with a steadily increasing supply of genetic and biochemical data will doubtless enable the construction of recombinant LAB that produce tailor-made EPS for specific food products (Jolly et al. 2002; Welman and Maddox, 2003). The genetic modification of eps genes could result in EPSs with different repeating units or with different chain length and, consequently, specific desired properties. Most LAB strains produce only small amounts of EPS (if any) and cannot be used for EPS-linked purposes. Investigations to improve EPS yield have shown, however, that production of EPS is affected by the bacterial growth phase, carbon and nitrogen sources, and pH and temperature. EPS overexpression has been demonstrated in L. lactis by placing part of the EPS-operon under the control

5 Genetic Engineering of Bacteria Used in Food Fermentation

of an inducible promoter (van Kraneburg et al., 1999). In S. thermophilus, ESP production was increased by altering expression of enzymes involved in central carbohydrate metabolism (Levander et al. 2002). The glycosyltransferases could be the target in engineering approaches. Replacing existing genes by heterologous glycosyltransferase genes which encode for transferases with different sugar specificities may enable the synthesis of EPS with different sugar composition (van Kranenburg et al.). Better knowledge of the polymerization and export processes might enable optimization of EPS production with altered repeating units or changing the rheological properties of native EPS by engineering of the molecular mass (Jolly and Stingele, 2001). 5.3.4 Proteolysis

Because of amino acid auxotrophy and lack of sufficient amounts of free amino acids in milk, lactic acid bacteria need an efficient proteolytic system for growth in milk. Proteolysis of these bacteria has been studied in great detail by genetic, biochemical, and ultrastructural methods. From these studies it has emerged that the proteolytic system of dairy lactococci and lactobacilli are remarkably similar both in their components and in their mode of action. The proteolytic system of lactococci consists of a cell-wall bound serin-protease (PrtP), three peptide transporters (Opp, DtpT, DtpP), and a variety of peptidases (Pep). The genes for most, but not all, of the enzymes necessary for casein degradation and transport of the degradation products have been cloned, sequenced, and analyzed in detail. From these data the following pictures emerge. Milk caseins were partially degraded by cell-wall bound protease into a large number of oligopeptides. Some of these oligopeptides (≤10 aa residues) were taken up by the oligopeptide and di and tripeptide transport systems and subsequently hydrolyzed to amino acids by a plethora of peptidases. Mutants missing transporter and/or peptidase genes were constructed by targeting deletion or disruption of the corresponding genes. Those missing the Opp system but still with di and tripeptide transport activity were unable to grow in milk. Mutants with increasing numbers of peptidase mutations had decreasing growth rates in milk – a fivefold peptidase mutant grew at one-tenth the rate of the wild type. In lactococci the genes for peptide transport systems and the peptidase were located on the chromosome, those for the proteases exclusively on plasmids (Kunji et al., 1996; Mierau et al., 1997; Law and Haandrikman, 1997; Christensen et al., 1999; Siezen, 1999; Doeven et al. 2005; Juille et al. 2005, Manso et al. 2005). The degradation of casein is a crucial process in formation of the texture and flavor in many fermented dairy products, especially cheeses. With the genetic and biochemical tools currently available it is possible to manipulate the pathways of protein and peptide degradation in LAB by quantitative and qualitative means. L. lactis strains that express heterologous proteases, for example neutral proteinase from Bacillus subtilis (van der Guchte et al. 1990) and peptidase from LAB and other genera (Leenhouts et al. 1998; Joutsjoki et al. 2002), have been constructed. Some were tested in cheese manufacture, ripening, and flavor development.

119

120

5.3 Perspectives and Objectives

The wealth of genetic information arising within the LAB genome sequencing project in combination with the development of sophisticated genomic and/or proteomic tools has resulted in better understanding of proteolytic pathways and their regulation in LAB (Kok et al. 2005; Hols et al. 2005); this will enable the construction of strains with controlled synthesis of amino acid catabolites and may include reduction of biogenic amines and controlled production of specific flavor compounds in fermented foods (Christensen et al. 1999; Smit et al. 2005). Proteins from milk and other foods are known to be precursors of many different biologically active peptides (Meisel and Bockelmann, 1999; Kitts and Weiler, 2003; Meisel and FitzGerald, 2003; Bouhallab and Bougle, 2004; Silva and Malcata, 2005). These peptides can be released in the active form during intestinal digestion or during fermentation. Fermented milks containing angiotensin-I-converting enzyme (ACE)-inhibitory peptides have been produced with selected LAB strains (Gobbetti et al. 2000; Muguerza et al. 2005). ACE inhibition results in an antihypertensive effect and may also affect other regulatory systems (Takano, 2002). Genetic engineering of the proteolytic system of LAB may provide the opportunity to overproduce these valuable peptides. 5.3.5 Metabolic Engineering of Lactic Acid Bacteria

Genetic engineering is direct improvement of the biochemical properties of cells by modification of specific reactions or introduction of new reactions using recombinant DNA technology. To develop strategies for metabolic engineering, a thorough understanding of the metabolic network and metabolic fluxes is necessary. LAB have a relatively simple and, in some species, well-known metabolism in which sugars are fermented mainly to lactic acid. Lactococcus lactis is the most extensively studied LAB and, therefore, the first employed in metabolic engineering efforts. An L. lactis strain has been constructed for efficient conversion of sugar into diacetyl by α-acetolactate decarboylase inactivation and simultaneous NADHoxidase overexpression. Approximately eighty percent of the carbon flux was found to be rerouted via α-acetolactate to the production of diacetyl (Hugenholtz et al. 2000). Diacetyl is essential as aroma compound in many fermented dairy products, for example butter and fresh cheeses. Overexpression of serine hydroxymethyltransferase in S. thermophilus resulted in an increase of acetaldehyde – a major flavor compound in yogurt- and folic acid formation (Chaves et al. 2002). Introduction and efficient expression of a heterologous alaD gene, encoding alanine dehydrogenase, in lactate dehydrogenase-deficient L. lactis cells resulted, in the presence of ammonium, in complete conversion of pyruvate to alanine. Inactivation of the endogenous alanine racemase (alr) gene led to stereospecific L-alanine production as the only end-product of fermentation (Hols et al. (1999). L-Alanine is used as a sweetener in the food industry and its in-situ production can lead to dairy products with intrinsic sweetness. Further metabolic engineering activity focuses on the removal of galactose and/or lactose from dairy products, and the production of nonfermentable (low calorie) sugars, oligosaccharides, and

5 Genetic Engineering of Bacteria Used in Food Fermentation

vitamins (e.g. folic acid) (Hugenholtz et al. 2002; Wisselink et al. 2002; Leroy and De Vuyst. 2004). On the basis of data derived from annotated genome sequences, complete metabolic networks of lactic acid bacteria can be established. These models, in connection with high-throughput genomic approaches, will enable efficient design and practical evaluation of novel metabolic engineering strategies for these bacteria (de Vos and Hugenholtz, 2004; Smid et al. 2005). 5.3.6 Stress Responses in Lactic Acid Bacteria

Lactic acid bacteria used in fermentation processes are, at different stages of their life cycle (starter culture handling, fermentation, and subsequent storage), subjected to a wide variety of harsh conditions. To survive the physical (high and low temperatures) and chemical (high acidity, nutritional starvation, oxidative and osmotic stress) changes in the environment, LAB have developed numerous stress-resistance mechanisms (for recent reviews see Duwat et al. 2000 and van der Guchte et al. 2002). Bacterial stress responses rely on complex regulatory circuits, which act together to improve stress tolerance. The bacterial heat shock response is characterized by elevated expression of several heat-shock proteins as chaperons, small heat-shock proteins, and specific proteases. Induction of the heat shock response by a short heat shock at sublethal temperatures increased the viability of LAB under subsequent stress conditions (Desmond et al. 2001; Gouesbet et al. 2002). A variety of different systems that may contribute to acid tolerance have been identified in LAB including different ATPases, the arginine deiminase pathway, ureases, decarboxylation reactions coupled with electrogenic transporters, and other less well characterized systems. (Rallu et al. 2000; van der Guchte et al. 2002, Grandvalet et al. 2005). Low-temperature adaptation and cryoprotection were found to be connected with the synthesis of cold-shock proteins induced at temperatures far below the optimum growth temperature in LAB. (Mayo et al. 1997; Wouters et al. 1999, 2001, Marceau et al. 2004). The presence of oxygen is a factor that greatly affects the outcome of a fermentation process. In the presence of oxygen, hydrogen peroxide is formed which, if not degraded by peroxidases and/or catalases, may accumulate and have deleterious effects, leading to cell death. After cloning and expression of the catalase gene of Lb. sake in a catalase-deficient Lb. curvatus strain which was frequently used for meat fermentation, no H2O2 accumulation was observed and the recombinant strain remained viable in the stationary phase (Hertel et al. 1998). Although LAB are regarded as fermentative anaerobes, in the presence of oxygen and heme Lactococcus lactis has a respiratory life cycle (Duvat et al. 2001, Gaudu et al. 2002). Whole-genome microarray analysis led to an optimized procedure for starter production under aerobic conditions; this resulted in increased biomass production by different industrially used L. lactis strains. Cells grown under aerobic conditions also had improved stress-tolerance. The amount of starter cul-

121

122

5.4 Methods

tures produced by this technology is measured in tons per year, and is tending to increase (Petersen et al. 2005) Stress response of LAB is currently a field of extensive research. A better understanding of the molecular basis of different stress response mechanisms and their interaction will in future enable the development of new strategies to screen and select for stress-tolerant or sensitive strains. Alternatively, strains used in many fermentation processes may be directly manipulated by use of recombinant gene technology.

5.4 Methods 5.4.1 Transformation

In the last 20 years or so sophisticated genetic tools – efficient transformation and special vector systems – have been developed which enable gene cloning, expression, and regulation of hom*ologous and heterologous genes. The transformation of LAB is routinely performed using electroporation (Harlander, 1987; Holo and Nes, 1989; Powell et al., 1988. Serror et al. 2002). Several procedures enable efficient transformation, even of strains which were resistant to the formerly used method of poly(ethylene glycol) (PEG)-induced protoplast transformation, and are also useable for many industrial strains. In addition, conjugal gene-transfer systems enable efficient exchange of plasmids among lactic acid bacteria. 5.4.2 Gene Delivery and Expression Systems

Many vector systems now enable cloning and expression of genes from different sources, random and targeted inactivation of genes, selection for promoter, terminator, and signal sequences, and anchoring of proteins to the surface of lactococci (Kok et al., 1984; Law, J. et al. 1995; Leenhouts et al., 1998; Maguin et al., 1996; O’Sullivan et al., 1996; Poquet et al., 1998; Russel and Klaenhammer, 2001; Simon and Chopin, 1988; van der Guchte et al., 1989; van der Vossen et al., 1985). Only one of the most sophisticated expression vector systems, which enables very efficient control of gene expression in Lactococcus and other lactic acid bacteria (de Ruyter et al., 1996), will be described briefly. The system makes use of the autoregulatory properties of the nisin gene cluster. Nisin, at concentrations well below of the minimal inhibitory concentration, acts as an inducer from outside via a two-component signal-transduction system – a histidine protein kinase (NisK), and a response repressor (NisR). The two genes, nisK and nisR under the control of a constitutive promoter were delivered by recombinant plasmids or are integrated into the chromosome of the expression

5 Genetic Engineering of Bacteria Used in Food Fermentation

strain. The gene to be expressed is fused to the nisA promoter which is part of the expression vectors. Vectors for transcriptional and translational fusions have been constructed. hom*ologous and heterologous proteins can be produced in amounts up to 47% of total cell protein with increasing amounts of the inducer. This system has become one of the most successful and widely used tools for regulated gene expression in Gram-positive bacteria. The NICE system has been used for different purposes – over-expression of hom*ologous and heterologous genes, metabolic engineering, expression of membrane proteins, protein secretion and anchoring in the cell envelope, expression of toxic products, analysis of essential genes, and large scale applications (an overview has been published by Mierau and Kleerebezem, 2005). In addition, a plethora of “food-grade” vectors is now available both for delivery and expression of exogenous genes via native or recombinant plasmids or by integration into the bacterial chromosome. These vectors consist solely of DNA derived from LAB and are devoid of antibiotic resistance genes as selectable markers (Axelsson et al. 2003, Bron et al. 2002, Cotter et al. 2003, El Demerdash et al. 2006, Emond et al. 2001, Henrich et al. 2002, Leenhouts et al. 1996, Liu et al. 2005, Maguin et al. 1996, Platteeuw et al.; Russell and Klaenhammer, 2001, Sasaki et al. 2004, Simoes-Barbosa et al. 2004, Sørensen et al., 2000; Takala and Saris, 2003, Takala et al. 2003; see also J. Kok in this book). With these tools many heterologous (eukaryotic or prokaryotic) peptides and proteins can be produced by use of Lactococcus lactis and, to a lesser extent, by other lactic acid bacteria. When required, these molecules can be secreted and/ or targeted to the cell envelope by fusion of genes to appropriate secretion and anchor signals. With this technique a variety of peptides and proteins could be anchored and at least partially presented at the cell surface of lactococci (Nouaille et al. 2003). This enabled alteration of the outside composition of the cells, which may aid understanding of the mechanisms of protein targeting. Changes in surface composition may also affect interactions between the bacteria and its environment and enable potentially important biotechnological applications, for example immobilization of enzymes on the bacterial surface (Buist et al., 1997, Poquet et al., 1998), fixing of cells to special surfaces, for example intestinal epithelial cells (Avall-Jääskeleinen and Palva, 2005), and display of epitopes. The latter includes epitopes of the human cytomegalovirus (Franke, 1998), of the human immunodeficiency virus, the Plasmodium falciparum merocoite stage surface antigene (Leenhouts et al., 1999), and the Clostridium tetani toxin C-fragment (Norton et al., 1995, 1996). Lactic acid bacteria producing the correct antigens and/or cytokines may, in future, be used as live bacterial vaccine-delivery systems (Martin et al. 2004, Norton et al., 1995; Robinson et al., 1997; Steidler et al., 1998; 2003). The development of such systems is a topic of extensive scientific effort. Some probiotic LABs are, in addition to their GRAS status, able to stimulate the immune system of the host. These properties and the availability of excellent genetic tools which enable the construction of food-grade recombinant (edible) LAB make the development of LAB as live vaccines a realistic prospect (Hanniffy et al. 2004, Nouaille et al. 2003, Seegers, 2002).

123

124

References

5.5 Conclusions

During the past few decades a good understanding has emerged of the microbial processes involved in the industrial scale production of fermented dairy products. Some of the microorganisms involved in milk fermentation, and especially Lactococcus lactis, have been so well characterized that sophisticated molecular and genetic tools are now available for the manipulation of these bacteria in many respects. Starter strains have been constructed, and will continue to be constructed, to enable better control of traditional fermentation processes, and to develop new products with higher nutritional values and health-promoting properties. Genetically engineered LAB may also be used for production of food-related products, for example neutraceuticals and other food additives such as flavor compounds and enzymes. Extensive research effort is now being devoted to the use of LAB as production and delivery systems for pharmaceutically active substances and vaccines. Despite the importance of fermented foods for nutritional purposes in less-developed regions of the world, little is known about the microbial and enzymatic processes in many fermentations, and this indicates there is a clear and urgent need for further research in this field. The selection and development of optimized starter cultures which can be easily propagated, stored at ambient temperatures, and which are resistant to different stress factors encountered during fermentation and storage is only one aspect of improvement among many fermentation processes. The genome sequences of approximately 30 strains from all biotechnologically important LAB have been or are being determined. Hence, with the vast amount of genetic data available, better understanding is emerging of their biochemical potential, technological properties, and health-promoting activity. Comparative and functional genetics will enable determination of similarities and differences for these bacteria. Undoubtedly, this will result in a wealth of new screening, selection, and genetic engineering strategies applicable to fermentation processes in the production of food.

References Alexandre, H., P.J. Costello, F. Remize, J. Altermann. E., W. M. Russel, M.A. AzcarateGuzzo, and M. Guilloux-Benatier. 2004. Peril, R. Barrangou, B. L. Buck, O. McAuSaccharomyces cerevisiae–Oenococcus oeni cliffe, N. Southern, A. Dobson, T. Doung, interaction in wine: current knowledge and M. Callanan; S. Lick, A. Hamrich, R. Cano, perspectives. Int. J. Food Microbiol.93: and T. Klaenhammer. 2005. Complete ge141–154. nome sequence of the probiotic lactic acid Almiron-Roig, E., E. Mulholland, M.J. Gasson, bacterium Lactobacillus acidophilus NCFM. and A.M.Griffin. 2000. The complete cps Proc. Natl. Acad. Sci. USA 102:3906–3912. gene cluster from Streptococcus thermophilus Avall-Jääskeläinen, S. and A. Palva. 2005. LacNCFB 2393 involved in the biosynthesis tobacillus surface layers and their applicaof a new exopolysaccharide. Microbiology, tion. FEMS Microbiol. Rev. 29:511–529. 146:2793–2802.

5 Genetic Engineering of Bacteria Used in Food Fermentation Axelsson, L. 1998. Lactic acid bacteria: classification and physiology, pp. 1–72. In, S. Salminen and A. Von Wright (eds). Lactic acid bacteria: Microbilogy and Functional Aspects, 2nd ed., Marcel Dekker, Inc, New York Axelsson, L., G. Lindstad, and K. Naterstad. 2003. Development of an inducible gene expression system for Lactobacillus sakei. Lett. Appl. Microbiol. 37:115–120. Bolotin, A., S.Mauger, K. Malarme, S.D. Ehrlich, and A. Sorokin. 1999. Low redundancy sequencing of the entire Lactococcus lactis IL 1403 genome. Antonie van Leeuwenhoek 76:27–76. Bolotin, A., P. Winker, S. Mauger, S. Jaillon, K. Malarme, J. Weissenbach, S.D. Ehrlich, and A. Sorokin. 2001.The complete genome sequence of the lactic acid bacteria Lactococcus lactis subsp. lactis IL 1403. Genome Res. 11:128–132 Bolotin, A., B. Quinquis, P. Renault, A. Sorokin, S. D. Ehrlich, S. Kulakauskas, A. Lapidus, E. Goltsman, M. Mazur, G. D. Pusch, M. Fonstein, R. Overbeek, N. Kyprides, B. Prunelle, d. Prozzi, K. Ngui, D. Masuy, F. Hancy, S. Burteau, M. Boutry, J. Delcour, A. Goffeau, and P. Hols. 2004. Complete sequence and comparative genome analysis of the dairy bacterium Streptococcus thermophilus. Nat. Biotechnol. 22:1554–1558. Bouhallab, S. and D. Bougle. 2004. Biopeptides of milk: caseinophosphopeptides and mineral bioavailability. Reprod. Nutr. Dev. 44:493–498. Bron, P.A., M.G. Bencimol, J. Lambert, E. Palumbo, M. Deghorain, J. Delcour, W.M. de Vos, M. Kleerebezem,and P. Hols. Use of the alr gen as a food-grade selection marker in lactic acid bacteria. Appl. Environ. Microbiol. 68:5663–5670. Buist, G. 1997. AcmA of Lactococcus lactis, a cell-binding major autolysin. Ph.D. thesis, University of Groningen, Haren, The Netherlands. Chabot, S., H.-L. Yu, L. De Leseleuc, D. Cloutier, M.-R. Van Calsteren, M. Lessard, D. Roy, M. Lacroix, and D. Oth. 2001. Exopolysaccharides from Lactobacillus rhamnosus RW-9595M stimulate TNF, IL-6 and IL-12 in human and mouse cultured immunocompetent cells, and IFN-gamma in mouse splenocytes. Lait 81:683–697.

Chaves, A. C. S. D., M. Fernandez, A.L.S. Lerayer, I. Mierau, M. Kleerebezem, and J. Hugenholtz. 2002. Metabolic engineering of acetaldehy production by Streptococcus thermophilus. Appl. Environ. Microbiol. 68:5656–5662. Chopin, M.C., Chopin, A., and E. Bidnenko. 2005. Phage abortive infection: variations on a theme. Curr. Opin. Microbiol. 8:473–479. Christensen, J.E., E.G. Dudley, J.A. Pederson, and J.L. Steele. 1999. Peptidases and amino acid catabolism in lactic acid bacteria. Antonie van Leeuwenhoek 76:217–246 Coffey, A. and R.P. Ross. 2002. Bacteriophageresistance systems in dairy starter strains: molecular analysis to application. Antonie van Leeuwenhoek 82:303–321. Cogan, T.M. and K.N. Jordan. 1994. Metabolism of Leuconostoc bacteria. J. Dairy Sci. 77:2704–2717. Cotter, P.D., C. Hill, and R.P. Ross.2003. A food-grade approach for functional analysis and modification of native plasmids in Lactococcus lactis. Appl. Environ. Microbiol. 69:702–706. Daeschel, M.A. and T.R. Klaenhammer. 1985. Association of a 13.6-megadalton plasmid in Pediococcus pentosaceus with bacteriocin activity. Appl. Environ. Microbiol. 50:1528–1541. Daeschel, M.A., R.E. Andersson, and H.P. Fleming. 1987. Microbial ecology of fermenting plant material. FEMS Microbiol. Rev. 46:357–367. Delcour, J., T. Ferain, and P. Hols. 2000. Advances in the genetic of thermophilic lactic acid bacteria. Curr. Opin. Biotechnol. 11:497–504. De Ruyter, P.G.G.A., O.P. Kuiper, and W.M. deVos. 1996. Controlled gene expression for Lactococcus lactis with the food-grade inducer Nisin. Appl. Environ. Microbiol. 62:3662–3667. De Vos, W.M. and J. Hugenholtz. 2004. Engineering metabolic highways in Lactococci and other lactic acid bacteria. Trends Biotechnol. 22:72–79. De Vuyst, L. and B. Degeest. 1999. Heteropolysaccharides from lactic acid bacteria. FEMS Microbiol. Rev. 23:153–177. De Vuyst, L., F. De Fin, F. Vaningelgem, and B. Degeest. 2001. Recent developements in the biosynthesis and application of hetero-

125

126

References polysaccharides from lactic acid bacteria. Int. Dairy J. 11:687–707. Delcour, J., T. Ferain, and P. Hols. 2000. Adcances in the genetics of thermophilic lactic acid bacteria. Curr. Opin. Biotechnol. 11:497–504. Desmond, C., C. Stanton, G.F. Fitzgerald; K. Collins, and R.P. Ross.2001. Environmental adaption of probiotic lactobacilli towards improved performance during spray drying. Int. Dairy J. 11:801–811. Dicks, L. M., F. Dellaglio, and M.D. Collins. 1995. Proposal to reclassify Leuconostoc oenos as Oenococcus oeni [corrig.] gen. nov., comb. nov. International Journal of Systematic Bacteriology 45:395–397. Djordjevic, G.M., D.J. O’Sullivan, S.A. Walker, M.A. Conkling, and T.R. Klaenhammer. 1997. Bacteriophage-triggered defence systems: phage adaption and design improvements. Appl. Environ. Microbiol. 63:4370–4376. Doeven, M.K., J. Kok, and B. Poolman. 2005. Specificity and selectivity determinants of peptide transport in Lactococcus lactis and other microorganisms. Mol. Microbiol. 57:640–649. Dudez, A. M., S. Chaillou, L. Hissler, R. Stentz, M. Champomier-Vergès, C.A. Alpert and M. Zagorec. 2002. Physical and genetic map of the Lactobacillus sakei 23K chromosome. Microbiology. 148:421–431. Duwat, P., S.S. Cesselin, and A. Gruss. 2000. Lactococcus lactis, a bacterial modell for stress responses and survival. Int. J. Food Microbiol. 55:83–86. Duwat, P., S. Sourice, B. Cesselin, G. Lamberet, K. Vido, P. Gaudu, Y. LeLoir, F. Violet, P. Loubière, and A. Gruss. 2001. Respiration capacity of the fermenting bacterium Lactococcus lactis and its positive effects on growth and survival. J. Bacteriol. 183:4509–4516. El Demerdash, H.A. Budde-Niekiel, A. Heller, K.J. and Geis, A. 2006. Yoghurt fermentation at elevated temperatures by strains of Streptococcus thermophilus expressing a small heat-shock protein: Application of a two-plasmid system for constructing foodgrade strains of Streptococcus thermophilus. Émond, É., R. Lavallée, G. Drolet, S. Moineau, and G. LaPointe. 2001. Molecular characterization of a theta replication plasmid and its use for development of a two-component

food-grade cloning system for Lactococcus lactis.. Appl. Environ. Microbiol. 67:1700– 1709. Forde, A and G.F. Fitzgerald. 1999. Bacteriophage defence systems in lactic acid bacteria. Antonie van Leeuwenhoek 76:89–113. Fox, P.F., J.A. Lucey, and T.M. Cogan. 1990. Glycolysis and related reactions during cheese manufacture and ripening. Crit.Rev. Food Sci. Nutr. 29:237–253. Franke, C.M. 1998. Topology of a type I secetion system for bacteriocins of Lactococcus lactis. Ph.D. thesis, university of Groningen, Haren, The Netherlands. Garvie, E. 1960. The genus Leuconostoc and its nomenclature. J. Dairy Science 27:301–306. Gaudu, P., K. Vido, B. Ceselin, S. Kalukauskas, J. Tremblay, L. Rezaiki, G. Lamberet, S. Sourice, P. Duwat, and A. Gruss. 2002. Respiration capacity and consequences in Lactococcus lactis. Antonie van Leeuwenhoek. 82:263–269 Geis, A., J. Singh, and M. Teuber. 1983. Potential of lactic streptococi to produce bacteriocin. Appl. Environ. Microbiol. 45:205–211. Germond, J.E., M. Delley, N. Damico, and S.J. Vincent. 2001. Hetereologous expression and characterization of the exopolysaccharide from Streptococcus thermophilus Sfi39. Eur. J. Biochem. 268:5149–5156. Gobbetti, M., P. Ferranti, E. Smacchi, F. Goffredi, and F. Addeo. 2000. Production of angiotensin-I-converting-enzyme-inhibitory peptides in fermented milks started by Lactobaccilus delbrueckii subsp. bulgaricus and Lactococcus lactis subsp. cremoris FT4. Appl. Environ. Microbiol. 66:3898–3904. Gonzales, C.F. and L.L. McKay. 1986. Evidence for plasmid linkage of raffiose utilization and associated α-galactosidase and sucrose hydrolase activity in Pediococcus pentosaceus. Appl. Environ. Microbiol. 51:105–109 Gouesbet, G., G. Jan, and P. Boyaval. 2002. Two-dimensional electrophoresis study of Lactobacillus delbrueckii subsp. bulgaricus thermotolerance. Appl. Environ. Microbiol. 68:1055–1063. Grandvalet, C., F. Coucheney; C. Beltramo, and J. Guzzo. 2005. CtsR is the master regulator of stress response gene expression in Oenococcus oeni. J. Bacteriol. 187: 5614–5623.

5 Genetic Engineering of Bacteria Used in Food Fermentation Guanine, C.M., P.D. Potter, C. Hill, and R.P. Ross. 2005. Microbial solutions to microbial problems: lactococcal bacteriocins for the control of undesirable biota in food. J. Appl. Microbiol. 98:1316–1325 Hammes, W.P. and R.F. Vogel. 1995. The genus Lactobacillus, pp.19–54. In, B.J.B. Wood and W.H. Holzapfel (eds). The Genera of Lactic Acid Bacteria. Chapman and Hall, London Hammes, W.P., A. Bantleon, and S. Min. 1990. Lactic acid bacteria in meat fermentation. FEMS Microbiol. Rev. 87:165–173 Harlander, S.K. 1987. Transformation of Streptococcus lactis by electroporation, pp. 229–233. In: J.J. Ferretti and R. Curtiss III (ed.), Streptococcal genetics. American Society for Microbiology, Washington, D.C. Hannify, S., U. Wiedermann, A. Repa, A. Mercenier, C. Daniel, J. Fioramonti, H. Tlaskolova, H. Kozakova, H. Israelson, S. Madsen, A. Vrang, P. Hols, J. Delcour, P. Bron, M. Kleerebezem, and J. Wells.2004. Potential and opportunities for use of recombinant lactic acid bacteria in human health. Adv. Appl. Microbiol. 56:1–64. Henrich, B., J.R. Klein, B. Weber, C. Delorme; P. Renault, and U. Wegmann. 2002. Food-grade delivery system for controlled gene expression in Lactococcus lactis. Appl. Environ. Microbiol. 68:5429–5436. Hertel, C., G. Schmidt, M. Fischer, K. Oellers, and Hammes, W. 1998. Oxygen-dependent regulation of the expression of the catalase gene katA of Lactobacillus sakei LTH677. Appl. Environ. Microbiol. 64:1359–1365. Hickey, R.M., D.P. Twomey, P. Ross, and C. Hill. 2001. Exploitation of plasmid pMRC01 to direct transfer of mobilizable plasmids into commercial lactococcal starter strains. Appl. Environ. Microbiol. 67:2853–2858. Hill, C., L.A. Miller, and T.R. Klaenhammer. 1990. Cloning, expression, and sequence determination of a bacteriophage fragment encoding bacteriophage resistance in Lactococcus lactis. J. Bacteriol. 172:6419–6426. Hill, C. 1993. Bacteriophage and bacteriophage resistance in lactic acid bacteria. FEMS Microbiol. Lett. 12:132–142. Holo, H. and I.F. Nes. 1989. High-frequency transformation by electroporation of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol. 55:3119–3123

Hols, P., M. Kleerebezem, A.N. Schank, T. Ferain, M. Hugenholtz, J. Delcour, and W. de Vos. 1999. Conversion of Lactococcus lactis from hom*olactic to hom*oalanine fermentation through metabolic engineering. Nat. Biotechnol. 17:588–592. Hols, P., F. Hancy; L. Fontaine; B: Grossiord, D. Prozzi, N. Leblond-Bourget, B. Decaris, A. Bolotin, C. Delorme, S.D. Ehrlich, E. Guedon, V. Monnet, P. Renault, and M. Kleerebezem. 2005. New insights in the molecular biology and physiology of Streptococccus thermophilus revealed by comparative genomics. FEMS Microbiol. Rev. 29:435–463. Hugenholtz, J., M. Kleerebezem, M. Starrenburg, J. Delcour, J., W. de Vos, and P. Hols. 2000. Lactococcus lactis as acell factory for high-level diacetyl production. Apll. Environ. Microbiol. 66:4112–4114. Hugenholtz, J.; W. Sybesma, M.N. Groot, W. Wisselink, V. Ladero, K. Burgess, D. van Sinderen, J.-C. Piard, G. Eggink, E.J. Smid, G. Savoy, F. Sesma, T. Jansen, P. Hols, and M. Kleerebezem. 2002. Metabolic engineering of lactic acid bacteria for the production of nutraceuticals. Antonie van Leeuwenhoek 82:217–235. Hurst, A. 1973. Microbial antagonism in foods. Can. Inst. Food Sci. Technol. J. 6:80–90 Jolly, L. and F. Stingele. 2001. Molecular organization and funtionality of exopolysaccharide gene cluster in lactic acid bacteria. Int. Dairy J. 11:733–745. Jolly, L., S.J.F. Vincent, P. Duboc, and J.-R. Neeser. 2002. Exploiting exopolysaccharides from lactic acid bacteria. Antonie van Leeuwenhoek 82:367–374. Josephsen, J and H. Neve. 2004. Bacteriophages and antiphage mechanisms of Lactic Acid Bacteria. In: Salminen, S. and van Wright, A. (Eds) Lactic Acid Bacteria: Microbiology and functional aspects, 3rd edn (pp. 295–349). Marcel Dekker Inc., New York Joutsjoki, V., S. Luoma, M. Tamminen, E. Johansen, and A. Palva, A. 2002. Recombinant Lactococcus starters as a potential source of additional peptidolytic activity in cheese ripening. Appl. Microbiol. 92:1159–1166. Juille, O., D. Le Bars, and V. Juillard. The specificity of oligopeptide transport by

127

128

References Streptococcus thermophilus resembles that of Lactococcus lactis and not that of pathogenic streptococci. Microbiology 151:1987–1994. Kim, S.G., and C.A. Batt. 1991.Antisense mRNA-mediated bacteriophage resistance in Lactococcus lactis ssp. lactis. Appl. environ. Microbiol. 57:1109–1113. Kitts, D.D. and K. Weiler. 2003. Bioactive proteins and peptides from food sources. Application of bioprocesses used in isolation and recovery. Curr. Pharm. Des. 9:1309–1329. Klaenhammer, T. R. 1987. Plasmid-directed mechanisms for bacteriophage defense in lactic streptococci. FEMS Microbiology Reviews 46:313–325. Klaenhammer, T.R. 1993. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev. 12:39–86. Klaenhammer, T.R., R. Barrangou, B.L. Buck, M.A. Azcarate-Peril, and E. Altermann. 2005. Genomic features of lactic acid bacteria effecting bioprocessing and health. FEMS Microbiol. Rev. 29:393–409 Kleerebezem, M., J. Boekhorst, R. van Kranenburg, D. Molenaar, O. P. Kuiper, R. Leer, R. Tarchini, S. A. Peters, H. M. Sandbrink, M. W. Fiers, W. Stieckema, R. M. Landhorst, P. A. Bron, S. M. Hoffer, M. N. Groot, R. Kerkhoven, M. deVries, B. Ursing, W. M. deVos, and R. J. Siezen. 2003. Complete genom sequenze of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sci. USA 100:1990–1995 Kok, J., J.M.B.M. van der Vossen, and G. Venema. 1984. Construction of plasmid cloning vectors for lactic streptococci which also replicate in Bacillus subtilis and Escherichia coli. Appl. Environ. Microbiol. 48:726–731. Kunji, E.R.S., I. Mierau, A. Hagting, B. Poolman, and W.N. Konings. 1996. The proteolytic system of lactic acid bacteria. Ant. van Leeuwenhoek. 70:87–221. Kok, J., G. Buist, A. L. Zomer, S.A F.T. van Hijum, and O.P. Kuiper. 2005. Comparative and functional genomics of lactococci. FEMS Microbiol. Rev. 29:411–433. Kunkie, R.E. 1991. Some role of malolactic fermentation in wine making. FEMS Microbiol. Rev. 88:55–72. Lamothe, T., L. Jolly, B. Mollet, and F.Stingele. 2002.Genetic and biochemical characterization of exopolysaccharide bio-

synthesis by Lactobacillus delbrueckii subsp. bulgaricus. Arch. Microbiol. 178:218–228. Law, J., and A. Haandrikman. 1997. Proteolytic enzymes of lactic acid bacteria. Int. Dairy J. 7:1–11. Law, J., G. Buist, A. Haandrikman, J. Kok, G. Venema, and K. Leenhouts. 1995. A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes. Appl. Environ. Microbiol. 177:7011–7018. Leenhouts, K., G. Buist, A. Bolhuis, A. ten Berge, J. Kiel, I. Mierau, M. Dabrowska, G. Venema, and J. Kok. 1996. A general system for generating unlabelled gene replacements in bacterial chromosomes. Mol. Gen. Genet. 253:217–224. Leenhouts, K., A. Bolhuis, G. Venema, and J. Kok. 1998. Construction of a food-grade multiple-copy integration system for Lactococcus lactis. Appl. Microbiol. Biotechnol. 49:417–423. Leenhouts, K., G. Buist, and J. Kok. 1999. Anchoring of proteins to lactic acid bacteria. Antonie van Leeuwenhoek 76:367–376. Leroy, F. and L. De Vuyst. 2004. Lactic acid bacteria as functional starter cultures for the food fermentation. Trends Food Sci: Technol. 15:67–78. Levander, F., M. Svensson, and P. Rådström. 2002. Enhanced exopolysaccharide production by metabolic engineering of Streptococcus thermophilus. Appl.Environ. Microbiol. 68:784–790. Liu, C.Q., P. Su, N. Khunajakr, Y.M. Deng, S. Sumual, W.S. Kim, J.E. Tandianus, and N.W. Dunn. 2005. Development of food-grade cloning and expression vectors for Lactococcus lactis. J. Appl. Microbiol. 98:127–135. Maguin, E., H. Prevost, S.D. Ehrlich, and A. Gruss. 1996. Efficient insertional mutagenesis in lactococci and other Gram-positive bacteria. J. Bacteriol. 178:931–935. Manso, M.A., J. Leonil, M. Piot, V. Gagnaire. 2005. Isolation and characterization of a Lactobacillus helveticus ITG LH1 peptidaserich sub-proteome. Int. J. Food Microbiol. In press Marceau, A., M. Zagorec, S. Chaillou; T. Méra, and M.-C. Champomier-Vergès. 2004. Evidence for involvement of at least six proteins in adaptation of Lactobacillus sakei to cold temperatures and addition of

5 Genetic Engineering of Bacteria Used in Food Fermentation NaCl: Appl: Environ. Microbiol. 70: 7260–7268. Martín, M.C., M. Fernández, J.M. MartínAlonso, F. Parra, J.A. Boga, M.A. Alvarez. 2004. Nisin-controlled expression of Norwalk virus VP60 protein in Lactobacillus casei. FEMS Microbiol. Lett. 237:385–391. Mayo, B., S. Derzelle, M. Fernández, C. Léonard, T. Ferain, P. Hols, J.E. Suárez, and J. Delcour. 1997. Cloning and characterization of cspL and cspP, two cold-inducible genes from Lactobacillus plantarum. J. Bacteriol. 179:3039–3042. McGrath, S., G.F. Fitzgerald, and D. van Sinderen. 2001. Improvement and optimization of two engineered phage resistance mechanisms in Lactococcus lactis. Appl. Environ. Microbiol. 67:608–616. McGrath, S., J.F. Seegers, G.F. Fitzgerald, and D. van Sinderen. 1999. Molecular characterization of a phage-encoded resistance systemin Lactococcus lactis. Appl. Environ. Microbiol. 65:1891–1899. Meisel, H. and W. Bockelmann. 1999. Biofunctional peptides milk proteins: proteolytic activation and thropho-functional properties. Antonie van Leeuwenhoek 76:207–215. Meisel, H. and R.J. Fitzgerald. 2003. Biofunctional peptides from milk proteins: mineral binding and cytomodulatory effects. Curr. Pharm. Des. 9:1289–1295. Mierau, I., E.R.S. Kunji, G. Venema, and J. Kok. 1997. Casein and peptide degradation in lactic acid bacteria. Biotechn. Gen. Engin. Rev. 14:279–301. Mierau, I. And M. Kleerebezem. 2005. 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Appl. Microbiol. Biotechnol. On line Muguerza, B., M. Ramos, E. Sánches, M.A. Manso, M. Miguel, A. Aleixandre, M.A. Delgado, and I. Recio. 2005. Antihypertensive activity of milk fermented by Enterococcus faecalis strains isolated from raw milk. Int. Dairy J. On line Nes, I.F., D.P. Diep, L.S. Håvarstein, M.B. Brurberg, V. Eijsink, and H. Holo. 1996. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie van Leeuwenhoek 70:17–32. Norton, P.M., R.W.F. LePage, and J.M. Wells. 1995. Progress in the developement of Lactococcus lactis as a recombinant mucosal

vaccine delivery system. Folia Microbiol. 40:225–230. Norton, P.M., H.W.G. Brown, J.M. Wells, A.M. Macpherson, P.W. Wilson, and R.W.F. LePage. 1996. Factors affecting the immunogenicity of tetanusd toxin fragment C expressed in Lactococcus lactis. FEMS Immunol. Med. Microbiol. 14:167–177. Nouaille, S., L.A.Ribeiro, A. Miyoshi, D. Pontes, Y. Le Loir, S.Costa Oliveira, P. Langella, and V. Azevedo. 2003. Heterologous protein production and delivery systems for Lactococcus lactis. Genet. Mol. Res.2:102–111. O’Sullivan, D.J., S.A. Walker, S.G. West, and T.R. Klaenhammer. 1996. Development of an expression strategy using a lytic phage to trigger explosive plasmid amplification and gene expression. Bio/Technol. 14:82–87. O’Sullivan, D., A. Coffey, G.F. Fitzgerald, C. Hill, and R.P. Ross. 1998. Design of a phage-insensitive lactococcal dairy starter strain via sequential transfer of naturally occuring conjugative plasmids. Appl. Environ. Microbiol. 64:4618–4622. O’Sullivan, L., M.P. Ryan, R.P. Ross, and C. Hill. 2003. Generation of food-grade lactococcal starters which produce the lantibiotics lacticin 3147 and lacticin 481. Appl. Environ. Microbiol. 69:3681–3685 Péant, B., G. LaPoint, C. Gilbert, D. Atlan, P. Ward, and D. Roy. 2005. Comparative analysis of the exopolysaccharide biosynthesis gene cluster from four strains of Lactobacillus rhamnosus. Microbiol. 151:1839–1851. Petersen, M.B., S.L. Iversen, K.I. Sorensen, and E. Johansen. 2005. The long and winding road from the research laboratory to industrial applications of lactic acid bacteria. FEMS Microbiol. Rev. 29:611–624. Peterson, C.S. 1960 Sauerkraut, In C.O. Chichester, E.M. Mrak, E.M. Steward (eds.) advances in Food Research, Vol. 10. Academic Press, London. Platteeuw, C., I. Van Alen-Boerrigter, S. van Schwalkwijk, and W.M. de Vos. 1996. Foodgrade cloning and expression system for Lactococcus lactis. Appl. Environ. Microbiol.62:1008–1013. Poquet, I., S.D. Ehrlich, and A. Gruss. 1998. An export-specific reporter designed for Gram-positive bacteria: application to Lactococcus lactis. J. Bacteriol. 180:1904–1912. Powell, I.B., M.G. Achen, A.J. Hillier, and B.E. Davidson. 1988. A simple and rapid

129

130

References method for genetic transformation of lactic streptococci by electroporation. Appl. Environ. Microbiol. 54: 655–660. Pridmore, R. D., B. Berger, F. Desiere, D. Vilanova, C. Barretto, A-C. Pittet, M.-C. Zwahlen, M. Rouvet, E. Altermann, R. Barrangou, B. Mollet, A. Mercenier, T. Klaenhammer, F. Arigoni, and M. A. Schell. 2004. The genome sequence of the probiotic intestinal bacterium Lactobacillus johnsonii NCC 533. Proc. Natl. Acad. Sci. USA 101:2512–2517. Rallu, F., A. Gruss, S.D. Ehrlich, and E. Maguin. 2000. Acid- and multistress-resistant mutants of Lactococcus lactis: identification of intracellular stress signals. Mol. Microbiol. 35:517–528. Robinson, K., L.M. Chamberlain, K.M. Schofield, J.K. Wells, and R.W.F. LePage. 1997. Oral vaccination of mice against tetanus with recombinant Lactococcus lactis. Nature Biotechnol. 15:653–657. Rodriguez, J.M., M.I. Martinez, N. Horn, and H.M. Dodd. 2002. Heterologous production of bacteriocins by lactic acid bacteria. Int. J. Food Microbiol. 80:101–116. Ross, R.P., M. Galvin, O. McAuliffe, S.M. Morgan, M.P. Ryan, D.P. Twomey, W. Meaney, and C. Hill. 1999. Developing applications for lactococcal bacteriocins. Antonie van Leeuwenhoek 76:337–346. Ross, R.P., S. Morgan, and C. Hill. 2002. Preservation and fermentation: past, presence and future. Int. J. Food Microbiol. 79:3–16. Ruas-Mediedo, P., J. Hugenholtz, and P. Zoon. 2002. An overview of the functionality of exopolysaccharides produced by lactic acid bacteria. Int. Dairy J. 12:163–171. Russell, W.M. and T.R. Klaenhammer. 2001. Efficient system for directed integration into the Lactobacillus acidophilus and Lactobacillus gasseri chromosomes via hom*ologous recombination. Appl. Environ. Microbiol. 67:4361–4364. Ryan, M.P., M.C. Rea, C. Hill, and R.P. Ross. 1996. An application in cheddar cheese manufacture for a strain of Lactococcus lactis producing a novel broad-spectrum bacteriocin, lacticin 3147. Appl. Environ. Microbiol. 62:612–619. Sandine, W. E. and P.R. Elliker. 1970. Microbially induced flavors and fermented foods – Flavor in fermented dairy products. J. Agric. Food Chemistry 18:557–567.

Sasaki, Y., Y. Ito, and T. Sasaki.2004. ThyA as a selection marker in construction of foodgrade host–vector and integration systems for Streptococcus thermophilus. Appl. Environ. Microbiol. 70:1858–1864. Seegers, F.M.L. 2002. Lactobacilli as live vaccine delivery vectors: progress and properties. Trends Biotechnol. 20:508–515. Serror, P., T.Sasaki, S.D. Ehrlich, and E. Maguin. 2002. Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis with various plasmids. Appl. Environ. Microbiol. 68:46–52. Shinoda, T.S., M. Kajiyama, K. Okhi, N. Yamamoto, E. Okada, K. Oshima, and M. Hattori. 2005. Complete genome sequence of Lactobacillus helveticus CM4. 8th Symposium on Lactic Acid Bacteria, the Netherlands, poster E011 Siezen, R.J. 1999. Multi-domain, cell-envelope proteinases of lactic acid bacteria. Antonie van Leeuwenhoek 76: 139–155. Silva, S.V. and F.X. Malcata. 2005. Caseins as a source of bioactive peptides. Int. Dairy J. 15:1–15. Simon, D., and A. Chopin. 1988. Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie 70:559–566. Simoes-Barbosa, A., H. Abreu, A.Silva Neto, A. Gruss, and P. Langella. A food-grade delivery system for Lactococcus lactis and evaluation of inducible gene expression. Appl. Microbiol. Biotechnol. 65:61–67. Simpson, W.J. and H. Taguchi. 1995. The genus Pediococcus, with notes on the genera Tetragenococcus and Aerococcus, pp. 125– 172. In, B.J.B. Wood and W.H. Holzapfel (eds). The Genera of Lactic Acid Bacteria. Chapman and Hall, London. Smit, E.J., F.J.H. van Enckevort, A. Wegkamp, J. Boekhorst, D. Molenaar, J. Hugenholtz, R.J. Siezen, and B. Teusink. 2005. Metabolic models for rational improvement of lactic acid bacteria as cell factories. J. Appl. Microbiol. 98:1326–1331. Smit, G., B.A. Smit, and W.J.M. Engels. 2005. Flavour formation by lactic acid bacteria and biochemical flavour profiling of cheese products. FEMS Microbiol. Rev. 29:591–610. Sørensen, K.J., R. Larsen, A. Kibenich, M.P. Junge, and E. Johansen. 2000. A food-grade cloning system for industrial strains of

5 Genetic Engineering of Bacteria Used in Food Fermentation Lactococcus lactis. Appl. Environ. Microbiol. 66:1253–1258. Steidler L., J. Viaene, W. Fiers, and E. Remaut. 1998. Functional display of a heterologous protein on the surface of Lactococcus lactis by means of the cell wall anchor of Staphylococcus aureus protein A. Appl. Environ. Microbiol. 65:342–345. Steidler, L., S. Neirynck, N. Huyghebaert, V. Snoeck, A. Vermeire, B. Goddeeris, E. Cox, J.P.Remon, and E. Remaut. 2003. Biological containment of genetically modified Lactococcus lactis for intestinal delivery of human interleukin 10. Nature Biotechnol. 12:785–789. Stingele, F., J.R. Neeser, and B. Mollet. 1996. Identification and characterization of the eps (Exopolysaccharide gene cluster from Streptococcus thermophilus Sfi6. J. Bacteriol. 178:1680–1690. Sturino,J.M. and T.R. Klaenhammer. 2002. Expression of antisense RNA targeted against Streptococcus thermophilus bacteriophages. Appl. Environ. Microbiol. 68:588–596. Sutherland, I.W. 1996. Extracellular polysaccharides, pp. 613–657. In: H.-J. Rehm, G. Reed, A. Pühler and P. Stadler (eds.) Biotechnology, 2nd ed., Vol 6: Products of Primary Metabolism. VCH, New York. Takano, T. 2002. Anti-hypertensive activity of fermented dairy products containing biogenic peptides. Antonie van Leeuwenhoek 82:333–340. Takala, T.M. and P.E. Saris. 2002. A foodgrade vector for lactic acid bacteria based on the nisin immunity gene nisI. Appl. Microbiol. Biotechnol. 59:467–471. Takala, T.M. and P.E. Saris, and S.S. Tynkkynen. 2003. Food-grade host/vector expression system for Lactobacillus casei baased on complementation of plasmid. associated phosphor-beta-galactosidase gene lacG. Appl. Microbiol. Biotechnol. 60:564–570. Vademuthu, E.R. 1994. The dairy Leuconostoc: use in dairy products. J. Dairy Sci. 77:2725–2737. Van Calsteren, M.R., C. Pau-Roblot; A. Begin, and D. Roy. 2002. Structure determination of the exopolysaccharide produced by Lactobacillus rhamnosus RW-9595M and R. Biochem. J. 363:7–17.

van der Guchte, M., J.M.B.M. van der Vossen, J. Kok, and G. Venema. 1989. Construction of a lactococcal expression vector: expression of hen egg white lysozyme in Lactococcus lactis. Appl. Environ. Microbiol. 55:224–228. van der Guchte, M., J. Kodde, J.M.B.M. van der Vossen, J. Kok, J., and G. Venema. 1990. Heterologous gene exprerssion in Lactococcus lactis subsp. lactis: Synthesis, secrection, and processing of Bacillus subtilis neutral protease. Appl. Environ. Microbiol. 56:2606–2611. van der Guchte, M., P. Serror, C. Chervaux, T. Smokvina, S.D. Ehrlich, and E. Maguin. 2002. Stress response in lactic acid bacteria. Antonie van Leeuwenhoek. 82: 187–216. Vaningelgem, F., M. Zamfir, F. Mozzi, T. Adriany, M. Vancanneyt, J. Swings, and L. De Vuyst. 2004. Biodiversity of exopolysaccharides produced by Streptococcus thermophilus strains reflected in their production and their molecular and functional characteristics. Appl. Environ. Microbiol. 70:900–912. van der Vossen, J.M.B.M., J. Kok, and G. Venema. 1985. Construction of cloning-, promoter and terminator screeningshuttle vectors for Bacillus subtilis and Streptococcus lactis. Appl. Environ. Microbiol. 50:540–542. van Kranenburg, R., J.D. Marugg, I.I. van Swam, N.J. Willem, and W.M. de Vos. 1997. Molecular characterization of the plasmid encoded eps gene cluster essential for exopolysaccharide biosythesis in Lactocccus lactis. Mol. Microbiol. 24:387–397. van Kranenburg, R., H.R. Vos, I.I. van Swam, M. Kleerebezem, and W.M. de Vos. 1999. Functional analysis of glycosyltransferase genes from Lactococcus lactis and other Gram-positive cocci: Complementation, expression, and diversity. J. Bacteriol. 181:6347–6353. Vandenbergh, P. A. 1993. Lactic acid bacteria, their metabolic products and interference with microbial growth. FEMS Microbiol. Rev. 12:221–238. Versari, A., G.P. Parpinello, and M. Cattaneo. 1999. Leuconostoc oenos and malolactic fermentation in wine: A review. Journal of Industrial Microbiology and Biotechnology 23:447–455. Welman, A.D. and I.S. Maddox. 2003. Exopolysacharides from lactic acid bacteria:

131

132

References perspectives and challenges. Trends Biotechnol. 21:269–274. Wisselink, H.W., R.A. Weusthuis, G. Eggink, J. Hugenholtz, and G.J. Grobben. 2002. Mannitol production by lactic acid bacteria: a review. Int. Dairy J. 12:151–161 Whittenbury, R. 1966. A study of the genus Leuconostoc. Archiv für Mikrobiologie 53:317–327 Wouters, J.A., F.M. Rombouts, W.M. de Vos, O.P. Kuipers, and T. Abee. 1999. Cold schock proteins and low-temperature response of Streptococcus thermophilus CNRZ302. Apll. Environ. Microbiol. 65:4436–4442.

Wouters, J.A., H. Frenkiel, W.M. de Vos, O. Kuipers, and T. Abee. 2001. Cold schock proteins of Lactococcus lactis MG1363 are involved in cryoprotection and in the production of cold-induced proteins. Appl. Environ. Microbiol. 67:5171–5178. Zubilla, M., R. Weill, E. Postaire, C. Goldman, R. Caro, and J. Boccio. 2000. Effect of probiotics and functional foods and their use in different diseases. Nut. Res. 21:569–579.

Part II Legislation in Europe

6 The Legal Situation for Genetically Engineered Food in Europe Rudolf Streinz and Jan Kalbheim

6.1 Introduction 6.1.1 The Need for Regulation

In 1985, in the context of its so called “new strategy” the Commission mentioned both “certain biotechnological techniques” and “other techniques and treatments” as areas of law requiring harmonization. By doing so it intended to secure the functioning of the common market by standardizing the relevant national rules (which were possible with regard to art. 30 TEC if they protected public health, but nevertheless might create conditions of unfair competition; cf. recitals 1 and 2 Novel Food Regulation (NFR) [1]). The Netherlands and Denmark, e.g., had statutory provisions which included rules concerning “novel foods”, in particular genetically modified foodstuffs. In the UK, also, there was a voluntary agreement between the food industry and the relevant authorities, which could be declared binding in accordance with the Food Safety Act 1990 [2]. 6.1.2 The History of the Regulation of Genetically Modified Food

Genetically modified food was originally treated as “novel food” and therefore included in the scope of application of the Novel Food Regulation. This regulation was the final result of a rather cumbersome process. Although the draft proposal for a regulation (OJ (EC) 1992, C 190/3) which the EC Commission (henceforth: Commission) presented in 1992, after years of discussion, was only the eleventh version, it was widely criticized, especially by the European Parliament. The criticism focused in particular on the rules concerning the scope of application and the labeling. Unfortunately the Commission considered this only in part when it presented its amended proposal for a Regulation (EC) of the European Parliament (EP) and of the Council concerning novel foods and food ingredients (OJ (EC)

136

6.1 Introduction

1994, C 16/10). Therefore, the following legislative procedures proved awkward – only a compromise put forward by the French Presidency enabled the Council to eventually formulate a common position, which was adopted on 23 October 1995 by a qualified majority against the votes of Denmark, Germany, Austria, and Sweden (OJ (EC) 1995, C 320/1). These four Member States regarded the rules on labeling as insufficient. This criticism was reflected in the EP during the joint legislative procedure (art. 251 TEC): Despite general acceptance of large parts of the proposal, the EP requested a number of amendments, especially with regard to labeling. These were in turn rejected by the Commission. Finally a compromise proposal which originated in the Conciliation Committee on 27 November 1996 under the Irish presidency was accepted by both the Council and the EP. The Novel Food Regulation nevertheless did not cover all genetically modified food and food ingredients. It expressly excluded additives, flavorings and extraction solvents from its scope of application (Art. 2 para. 1 lit. a–c NFR); these were therefore dealt with by Commission Regulation (EC) No 50/2000 [3], which made these substances subject to specific labeling requirements. Also, food and food ingredients which are to be delivered as such to the final consumer produced, in whole or in part, from genetically modified soybeans or genetically modified maize were not covered by the Novel Food Regulation because of lack of novelty at the time when the Novel Food Regulation was enacted. Again, specific labeling requirements were provided for, initially in the so called Supplementary Regulation [4] and then in the so called Replacement Regulation [5] which repealed the Supplementary Regulation. In addition, the placing on the market of genetically modified food normally involved the deliberate release of genetically modified organisms into the environment which was generally regulated by the so called Deliberate Release Directive 1990 [6] which provided for specific environmental safety requirements. In the Annex to its White Paper on Food Safety of 12 January 2000 [7] the Commission demanded in its catalog of actions to: • enact legal rules for the assessment, authorization and labeling of novel foods (White Paper on Food Safety, Annex: Action Plan on Food Safety, no. 6), • make the procedures for authorization of novel foods more transparent (ibidem, no. 50), • review Regulation (EC) No. 258/97 on novel foods and novel food ingredients (ibidem, no. 51), • introduce a general requirement for a new safety evaluation (ibidem, no. 41) and • complete and harmonize the provisions governing labeling (ibidem, no. 52). To implement these projects the Commission submitted a number of proposals which led to the enactment of two regulations: • Regulation (EC) No 1829/2003 of the European Parliament and of the Council of 22 September 2003 on genetically modified food and feed (henceforth: the GMFFR) [8], which removed genetically modified food and feed from the scope of application of the Novel Food Regulation and repealed the Replacement Regulation;

6 The Legal Situation for Genetically Engineered Food in Europe

• Regulation (EC) No 1830/2003 of the European Parliament and of the Council of 22 September 2003 concerning the labeling of genetically modified organisms and the traceability of food and feed products produced from genetically modified organisms and amending Directive 2001/18/EC [9] (henceforth: GMFFTraceLabelR) [10].

6.2 The Law Applicable to Genetically Modified Food 6.2.1 The Genetically Modified Food and Feed Regulation 6.2.1.1 Introduction According to its art. 1, the objective of the GMFFR is to provide the basis for ensuring a high level of protection of human life and health and animal, environmental, and consumer interests in relation to genetically modified food and feed by laying down provisions for Community procedures for authorization and supervision and for the labeling of such food and feed. Art. 2 of the GMFFR contains definitions of important terms used in the regulation. Unfortunately, twelve out of twenty-two terms are defined by referring to other Community acts. While it is true that references to the so called Basic Regulation [11] may serve to establish the coherence of food law rules, this makes it rather difficult for the lawyer – and even more so for the lay person – to grasp the law as it stands. Chapter II makes provisions for the authorization and supervision (art. 3–11) and for the labeling (art. 12–14) of genetically modified food. Chapter III provides for virtually identical rules concerning the same topics in relation to genetically modified feed (art. 15–23 and 24–26, respectively). This clearly shows the integral approach of the Commission to fashion a high level of protection for the whole food chain from the producer to the consumer. It is further ensured by the requirement to submit a single application under articles 5 and 17 where a product is likely to be used as both food and feed, which then leads to a single opinion from the European Food Safety Authority (henceforth: EFSA) and a single Community decision (art. 27 para. 1). The EFSA is under a duty to examine whether an application should be submitted both as food and feed (art. 27 para. 2). Chapter IV contains common provisions for genetically modified food and feed, relating inter alia to the Community register of genetically modified food and feed and the access to and the protection of the information contained therein (art. 28–31), to the Community reference laboratory (art. 32 and Annex: Duties and tasks of the Community reference laboratory), to emergency measures (art. 34), and to administrative review (art. 36).

137

138

6.2 The Law Applicable to Genetically Modified Food

6.2.1.2 Scope of Application According to its art. 3 para. 1 the Genetically Modified Food and Feed Regulation applies to • GMOs (cf. art. 2 no. 5 GMFFR) for food use (cf. art. 2 no. 8 GMFFR) – art. 3 para. 1 lit. a GMFFR – for example GM tomato; • food containing or consisting of GMOs (cf. art. 2 no. 6 GMFFR) – art. 3 para. 1 lit. b GMFFR – for example prepared pizza using GM tomato slices as a topping; • food produced from (cf. art. 2 no. 10 GMFFR) or containing ingredients produced from GMOs – art. 3 para. 1 lit. c GMFFR – for example tomato ketchup made from GM tomato, sugar made from GM sugar beet. Where this proves necessary, it is the task of the Standing Committee on the Food Chain and Animal Health (cf. art. 58 Basic Regulation) to determine whether a type of food falls within the scope of application of the GMFFR, using the regulatory procedure as defined in art. 5 Comitology Decision [12] (cf. infra 2.1.4.2)

6.2.1.3 Requirements for Genetically Modified Food and Feed Genetically modified food and feed covered by the GMFF Regulation must not – in accordance with the general principles of food law – have adverse effects on human health, animal health, or the environment or mislead the consumer. Likewise, they must not differ from foods or food ingredients which they are intended to replace to such an extent that their normal consumption would be nutritionally disadvantageous for the consumer or the animal (art. 4 para. 1, 16 para. 1 GMFFR).

6.2.1.4 Procedure Introduction Food law is based on the so called abuse principle (Mißbrauchsprinzip), according to which foodstuffs may be placed on the market autonomously, that is without prior authorization, if they meet the statutory requirements (under German law, especially, those of the protection of health, § 5, § 17 Lebensmittel- und Futtermittelgesetzbuch (LFGB – Food and Feed Act), and of the prohibition of deception, § 11, § 19 LFBG). In this respect, a general authorization to place foodstuffs on the market coupled with a corresponding power of prohibition reserved for the authorities has been put in place. This principle gives way to the so called prohibition principle (Verbotsprinzip) whenever specific needs of the preventive protection of health require this. The prohibition principle therefore provides for a general prohibition with reserved powers of authorization, forbidding everything which has not been explicitly permitted in the course of an authorization procedure. The regulatory concept of the GMFF Regulation employs the prohibition principle. Art. 4 para. 2 of the GMFFR provides that no person shall place on the market genetically modified food [13] unless it is covered by a prior authorization. The only exception to this rule, which remains applicable for three years from the date of application of the GMFF Regulation, i.e. until November 7th, 2006, is provided for by art. 47 of the GMFFR, which concerns the presence in food or feed of material

6 The Legal Situation for Genetically Engineered Food in Europe

which contains, consists of, or is produced from GMOs in a proportion no higher than 0.5%, provided that this presence is adventitious or technically unavoidable, the genetically modified material has benefited from a favorable opinion from the Community Scientific Committee(s) or the EFSA before the date of application of the GMFF Regulation, the application for its authorization has not been rejected in accordance with the relevant Community legislation, and detection methods are publicly available (art. 47 para. 1 GMFFR). Whereas genetically modified food covered by the Novel Food Regulation would have been subject to two different types of procedure, the GMFF Regulation provides for a single procedure (“one door – one key”) leading to the authorization to place a GMO or genetically modified food on the market, as required by art. 4 para. 2 of the GMFFR. This authorization, the legal fate of which exclusively depends on the provisions of the GMFF Regulation, may cover: • a GMO and foods containing or consisting of that GMO and foods produced from or containing ingredients produced from that GMO (art. 4 para. 4 lit. a GMFFR); or • food produced from a GMO and foods produced from or containing that food (art. 4 para. 4 lit. b GMFFR); or • an ingredient produced from a GMO and food containing that ingredient (art. 4 para. 4 lit. c GMFFR) The authorization may only be granted if the applicant has adequately and sufficiently demonstrated that the requirements of art. 4 para. 1 of the GMFFR are satisfied. The notification procedure which the Novel Food Regulation provided for and which allowed for the placing on the market of foods or food ingredients substantially equivalent to existing food or food ingredients without prior authorization has been abolished. The authorization procedure The application must come from an applicant established in the Community (art. 4 para. 6 GMFFR). According to art. 5 para. 2 of the GMFFR, the application for authorization shall be sent to the national competent authority of a Member State which acknowledges its receipt in writing to the applicant within 14 days, stating the date of the receipt of the application (art. 5 para. 2 lit. a (i) GMFFR), informs the European Food Safety Authority (EFSA), and makes available the application and any supplementary information supplied by the applicant to the EFSA (art. 5 para. 2 lit. a (ii) and (iii) GMFFR). The EFSA then informs, without delay, the other Member States and the Commission of the application and makes the application and any supplementary information supplied by the applicant available to them. The EFSA also makes the summary of the dossier, which is a necessary part of the application, available to the public (art. 5 para. 2 lit. b GMFFR). The mandatory content of the application is regulated by art. 5 paras 3–7 of the GMFFR and art. 1–7 Commission Regulation (EC) No 641/2004 [14]. The content of the application is designed to enable the EFSA to perform a scientific risk assessment covering both the environmental risk and risks to human and

139

140

6.2 The Law Applicable to Genetically Modified Food

animal health. The application must therefore be accompanied by information on the specification, including the transformation event(s) used (para. 3 lit. a), a copy of any available material demonstrating the food complies with the criteria referred to in art. 4 para. 1 (para. 3 lit. e), information on methods for detection, sampling, and identification of the transformation event (para. 3 lit. i), samples of food and their control samples, and information about the place where the reference material can be accessed (para. 3 lit. j), and, where appropriate, a detailed description of the methods of production and manufacture (para. 3 lit. d), information on the conditions for placing the food or foods produced from it on the market, including specific conditions for use and handling (para. 3 lit. h), and a proposal for postmarket monitoring with regard to use of the food for human consumption (para. 3 lit. k). In addition, a proposal for labeling the food in accordance with art. 13 paras. 2 and 3 of the GMFFR is required, or a reasoned statement why such labelling is unnecessary (para. 3 lit. f, g). Finally, the application must be accompanied by the information to be provided under the Cartagena Protocol [15], where applicable (para. 3 lit. c), and a summary of the dossier in a standardized form (para. 3 lit. l). In the case of an application concerning GMOs or food containing or consisting of GMOs the applicant must also provide a complete technical dossier supplying the information required by Annexes III and IV to the Deliberate Release Directive 2001 and information and conclusions about the environmental risk assessment conducted in accordance with the principles set out in Annex II to the Deliberate Release Directive 2001 or, where the placing on the market of the GMO has been authorized under part C of the Deliberate Release Directive 2001, a copy of the authorization decision, and a monitoring plan for environmental effects conforming with Annex VII to the Deliberate Release Directive 2001, including a proposal for the duration of the monitoring plan which may be different from the proposed period for the consent (art. 5 para. 5 GMFFR). In giving its opinion, the EFSA will normally respect a time limit of six months unless it has to request further information from the applicant, either of its own motion or prompted by a national competent authority (art. 6 paras 1 and 2 GMFFR). The opinion shall be based on: • verification that the particulars and documents submitted by the applicant are in accordance with Article 5 and an examination whether the food complies with the criteria referred to in Article 4 para. 1 (art. 6 para. 3 lit. a GMFFR); • any safety assessment of the food in accordance with the Basic Regulation or environmental risk assessment in accordance with art. 4 Deliberate Release Directive 2001, as performed by an appropriate national body on the request of the EFSA (art. 6 para. 3 lit. b, c GMFFR); • the Community reference laboratory’s test and validation of the method of detection and identification proposed by the applicant (art. 6 para. 3 lit. d GMFFR); • an examination of the applicant’s claim that the characteristics of the food are not different from those of its conventional counterpart (Art. 6 para. 3 lit. e GMFFR); and • in the event of requests to place products containing or consisting of GMO on the market, any opinion of a national competent authority which has replied within

6 The Legal Situation for Genetically Engineered Food in Europe

three months to the EFSA’s consultation on the application to the request of the environmental safety requirements referred to in the Deliberate Release Directive 2001 (Art. 6 para. 4 GMFFR). It is forwarded to the Commission, the Member States and the applicant, including a report describing the EFSA’s assessment of the food and stating the reasons for the opinion and the information on which the opinion is based, including the opinions of the competent authorities when consulted in accordance with paragraph 4 (art. 6 para. 6 GMFFR). A version of the opinion which is purged of any confidential information is also made public and may be commented on by the public within 30 days of publication (art. 6 para. 7 GMFFR). The opinion of the EFSA is taken into account by the Commission in producing a draft of the final decision refusing or granting authorization, which must be submitted for approval, within three months of receiving the EFSA’s opinion, to the Standing Committee on the Food Chain and Animal Health, which is a regulatory committee under art. 5 Comitology Decision and is composed of national experts. The Commission may diverge from the EFSA’s opinion, but it must then justify its position. If the Standing Committee approves of the draft decision, the Commission adopts it as the final decision. Otherwise, the Commission submits to the Council a proposal relating to the decision to be taken. Only if the Council rejects that proposal by qualified majority within three months, the Commission must re-examine its draft decision. Otherwise it is either adopted by the Council (if it approves of the draft) or by the Commission (if the Council fails to take a decision by qualified majority). This clearly shows that the Commission’s decision is a political decision, which the decision-making procedure is designed to carry through, even in the face of opposition from a (simple) majority of Member States [15*]. Although the Commission is free to propose the authorization of genetically modified food which the EFSA has assessed to be dangerous, the very fact that the EFSA publishes its report will make this very difficult. On the other hand, any proposal to refuse the authorization of food that has been assessed not to be dangerous would meet with criticism based on the right to freely choose and exercise a profession. The Commission without delay informs the applicant of the decision taken and publishes the details of the decision in the Official Journal of the EU (art. 7 para. 4 GMFFR). If the authorization is granted it is valid throughout the Community for ten years and renewable for further ten year periods (art. 11 GMFFR). It is without any bearing on the civil or criminal liability of any food operator in respect of the food concerned (art. 7 para. 7 GMFFR).

6.2.1.5 Labeling Conditions In addition to the standard requirements of Community law concerning the labeling of foodstuffs, art. 12 to art. 14 of the GMFFR and art. 4 para. 6 of the GMFFTraceLabelR provide for additional specific labeling requirements. These serve to enable the consumer to make an informed choice in relation to foodstuffs the production of which at some stage involved the use of techniques of genetic modification.

141

142

6.2 The Law Applicable to Genetically Modified Food

These specific labeling requirements apply to foods which are to be delivered as such to the final consumer or mass caterers (for example restaurants, canteens, hospitals) in the Community and which contain or consist of GMOs or are produced from or contain ingredients produced from GMOs (art. 12 para. 1 GMFFR). This means that genetically modified foods must be labeled, irrespective of whether or not DNA or proteins derived from genetic modification are contained in the final product. In contrast, products manufactured with the help of a genetically modified processing aid (for example genetically modified yeast, used in the production of wine) or obtained from animals fed with genetically modified feed or treated with genetically modified medicinal products (for example meat, milk or eggs) are not subject to the labeling requirements (cf. recital 16 GMFFR). The co-existence of transgenic crops and traditional or organic crops and the process of harvesting, storage, transport or processing make it practically impossible to achieve products that are 100% pure, that is absolutely not contaminated by GMOs. Art. 12 para. 2 of the GMFFR therefore excludes from the labeling requirements foods containing material which contains, consists of, or is produced from GMOs in a proportion no higher than 0.9 % of the food ingredients considered individually or food consisting of a single ingredient, if this presence is adventitious or technically unavoidable. To establish that the presence of this material is adventitious or technically unavoidable, operators must be in a position to supply evidence to satisfy the competent authorities that they have taken appropriate steps to avoid the presence of such material. Whether contamination occurring because of insufficient cleaning of transport facilities will be accepted as adventitious or technically unavoidable will probably require a decision by the European courts. This threshold only applies to GMOs which can be deemed to be safe because they have been authorized to be put on the market. If a GMO has not yet been authorized but has benefited from a favorable risk evaluation its adventitious or technically unavoidable presence up to a threshold of 0.5% is not illegal (art. 47 GMFFR); in that case it will not need to be mentioned on the label. Other GMOs are not tolerated in food or feed. Investigations by the competent authorities of the German Länder have shown that the labeling requirements are usually complied with; at the same time they found GMOs in a quantity below the threshold values in <10% to >90% of products analyzed [16]. The elements of the label Where an appropriate label is required, it must show the following elements: • for pre-packaged food, the words “This product contains genetically modified organisms” or “This product contains genetically modified [name of organism(s)]” (art. 4 para. 6 lit. a GMFFTraceLabelR); • in the list of ingredients as required by art. 6 Directive 2000/13/EC, the words “genetically modified” or “produced from genetically modified (name of the ingredient)” must appear in parentheses immediately after the ingredient con-

6 The Legal Situation for Genetically Engineered Food in Europe

•

cerned or in a footnote to the list in a font of at least the same size as the list (art. 13 para. 1 lit. a, d GMFFR); where the ingredient is designated by the name of a category, the words “contains genetically modified (name of organism)” or “contains (name of ingredient) produced from genetically modified (name of organism)” must appear in the list of ingredients or in a footnote to the list in a font of at least the same size as the list (art. 13 para. 1 lit. b, d GMFFR); where there is no list of ingredients, the words “genetically modified” or “produced from genetically modified (name of organism)” must appear clearly on the labeling (art. 13 para. 1 lit. c GMFFR); where the food is offered for sale to the final consumer as non-pre-packaged food, or as pre-packaged food in small containers of which the largest surface has an area of less than 10 cm2, the information required must be permanently and visibly displayed either on the food display or immediately next to it, or on the packaging material, in a font sufficiently large for it to be easily identified and read (art. 13 para. 1 lit. e GMFFR); a list of any characteristics or properties, as specified in the authorization, where a food is different from its conventional counterpart as regards composition, nutritional value or nutritional effects, intended use of the food, or implications for the health of certain sections of the population (art. 13 para. 2 lit. a GMFFR); a list of any characteristics or properties, as specified in the authorization, where a food may give rise to ethical or religious concerns (art. 13 para. 2 lit. b GMFFR); and as specified in the authorization, the labeling of foods which do not have a conventional counterpart shall also contain appropriate information about the nature and the characteristics of the foods concerned (art. 13 para. 3 GMFFR) [17].

Traceability and the unique identifier The shift in the basis of the labeling requirements away from the presence of DNA or modified protein in the product to the use of GMOs in the production of the product, to include foods produced from or containing ingredients produced from GMOs, makes it necessary to transmit and hold information that the food and feed consist of, contain or have been produced from GMOs. The rules to ensure this are contained in the GMFFTraceLabel Regulation. This regulation applies to products, including food and feed, consisting of, or containing, GMOs, placed on the market in accordance with Community legislation (art. 2 para. 1 lit. a GMFFTraceLabelR) and food and feed produced from GMOs, placed on the market in accordance with Community legislation (art. 2 para. 1 lit. b, c GMFFTraceLabelR). It requires operators who place a product consisting of or containing GMOs on the market for the first time to transmit in writing to the operator receiving the product the information that the product contains or consists of GMOs and the unique identifier of those GMOs (art. 4 para. 1 GMFFTraceLabelR). This information must be similarly transmitted to the operators receiving the product at all subsequent stages of placing the product on the market (art. 4

143

144

6.2 The Law Applicable to Genetically Modified Food

para. 2 GMFFTraceLabelR). An analogous requirement exists for food or feed produced from GMOs. When these are put on the market, the following information must be transmitted in writing to the operator receiving the product: • an indication of each of the food ingredients or of each of the feed materials or additives which is produced from GMOs (art. 5 para. 1 lit. a, b GMFFTraceLabelR) or, for products for which no list of ingredients exists, • an indication that the product is produced from GMOs (art. 5 para. 1 lit. c GMFFTraceLabelR). These requirements nevertheless do not apply to products falling under the de minimis rules contained in art. 12, 24 or 47 of the GMFFR (art. 4 para. 8, art. 5 para. 4 GMFFTraceLabelR). All operators involved must hold the information transmitted and information about by whom and to whom the product was sold for a period of five years from each transaction (art. 4 para. 4, art. 5 para. 2 GMFFTraceLabelR). The unique identifier referred to in art. 4 para. 1 of the GMFFTraceLabelR is made up of nine characters combined in a uniform way, using a format approved within the framework of the OECD. All unique identifiers are listed in the OECD’s Bio Track database. Commission Regulation (EC) No 65/2004 [18] contains detailed rules on the development and assignment of the unique identifier.

6.2.1.6 Other Questions New insights Whereas previously art. 12 of the NFR offered Member States the opportunity to restrict or suspend the trade in and use of genetically modified food when new insights justified considering that use of the product endangers human health or the environment, the new rules posit the Commission at the center of any such measure. Having obtained new insights, Member States must normally request the EFSA to give an opinion on whether a product still meets the conditions for its authorization (art. 10 para. 1 GMFFR). This opinion is the basis of the following administrative process which is essentially similar to the original authorization procedure. In the course of this process the Commission examines the opinion as soon as possible and takes appropriate measures in accordance with art. 34 of the GMFFR, which may include modification, suspension, or revocation of the (initial) authorization. If, however, it is evident that products authorized by or in accordance with this Regulation are likely to constitute a serious risk to human health, animal health, or the environment, art. 34 of the GMFFR refers to the procedures provided for in art. 53 and 54 of the Basic Regulation. According to art. 54 paras 1 and 3 of the Basic Regulation Member States may adopt interim measures until the Commission has put in place community-wide measures to deal with the problem. Sanctions Art. 45 of the GMFFR provides for a duty of the Member States to penalize breaches of its provisions by enacting rules which provide for effective, proportionate, and dissuasive penalties and to implement these rules effectively. Under German law this is achieved by § 6 and § 7 of the Act to implement regula-

6 The Legal Situation for Genetically Engineered Food in Europe

tions of the European Communities in the field of biotechnology (henceforth the ECBI Act) [19]. 6.2.2 Problems 6.2.2.1 Negative Labeling Recital 10 of the Novel Food Regulation expressly states that nothing shall prevent a supplier from informing the consumer on the labeling of a food or food ingredient that the product in question is not a novel food within the meaning of the Novel Food Regulation or that the techniques indicated in art. 1 para. 2 of the NFR were not used in the production of that food or food ingredient. This so called “negative labeling” (here the term “negative” does not imply any negative evaluation, but only refers to a lack of novelty of a foodstuff or of a novel food ingredient or the fact that the techniques indicated in art. 1 para. 2 of the NFR have not been used) is not mentioned again in the Novel Food Regulation. The GMFF Regulation does not mention the concept of negative labeling in relation to GM food or GM feed. Nevertheless the position on the legality of such negative labeling has not changed. With a view to European law it must be observed that the law of Member States regulating such labeling – in accordance with the general principles – must not breach primary community law, especially art. 28 TEC, that is the provisions of national law must not restrict the free movement of goods from other Member States in a discriminatory or disproportionate way. Although it was unclear for some time which precise requirements such labeling was subject to, these have been clarified in German law by the Novel Foods and Food Ingredients Instrument (NFI) [20] (cf. infra, Section 6.2.5.2).

6.2.2.2 Coexistence of Genetically Modified Food and Feed and Conventional or Organic Food and Feed Art. 43 of the GMFFR introduced into the Deliberate Release Directive 2001 a new art. 26a, which provides that Member States may take appropriate measures to avoid the unintended presence of GMOs in other products (para. 1) and requires the Commission to gather and coordinate information based on studies at Community and national level, observe developments regarding coexistence in the Member States, and, on the basis of the information and observations, develop guidelines on the coexistence of genetically modified, conventional, and organic crops (para. 2). It is therefore the task of the Member States to take measures to ensure co-existence. In Germany, art. 16a Biotechnology Act implements art. 26a Deliberate Release Directive 2001 (cf. infra Section 6.2.5.1 for details). Unintentional movements of GMOs between Member States and exports of GMOs to third countries are governed by Regulation (EC) No. 1946/2003 of the European Parliament and the Council of 15 July 2003 on transboundary movements of genetically modified organisms [21]. According to art. 14 of this Regulation (which is directly applicable in all Member States according to art. 249 para. 2

145

146

6.2 The Law Applicable to Genetically Modified Food

TEC) Member States shall take “appropriate measures” to prevent unintentional transboundary movements of GMOs. The scope of this Regulation is therefore limited to this case and does not deal with the problem of co-existence within the Member States. Some Member States have tried to ensure co-existence by declaring GM-free zones. An attempt by the Land Upper Austria to pass an Act declaring itself a GMfree zone was blocked by the Commission which prohibited it on the basis of art. 95 para. 5 TEC. This decision was upheld by the European Court of First Instance (ECFI) in its judgment of 5. October 2005 [22]. The ECFI found that both the Land and the Republic of Austria had not put forward evidence either to demonstrate that the structure of agricultural production was specific to Upper Austria and or to rebut the assessment of the EFSA that no proof had been presented establishing that that the territory of the Land Upper Austria contained unusual or unique ecosystems that required separate risk assessments [23]. The importance of the decision is not entirely clear, because it did not deal with the relevance of art. 26a Deliberate Release Directive 2001, which was only introduced after the facts of the case had occurred. But it has been suggested that it seems doubtful that art. 26a of the Deliberate Release Directive 2001 provides the final solution given its lack of substantive contours and that the (nonbinding) Commission Recommendation No. 2003/556/EC on Co-existence (Co-exRec) [24] will probably turn out to be the starting point for further European legislation [25]. The Commission’s Recommendation, nevertheless, is quite problematic. Although the Commission mentions the interests of European consumers in a real choice between GM food and non-GM food (1.1 para. 2 Co-exRec), its recommendation points out that only authorized GMOs can be cultivated in the EU and that the environmental and health aspects are already covered by the Deliberate Release Directive 2001, to claim that the pending issues still to be addressed in the context of co-existence concern solely economic aspects of the admixture of GM and nonGM crops (1.2 para. 4 Co-exRec). These economic aspects are, on the one hand, loss of income resulting from the duty to label crops as containing GMOs because of admixture of GMOs above the tolerance threshold and, on the other hand, the interest of the incoming producer – that is normally the producer interested in producing GM-crops – to avoid any unnecessary burden. The Commission’s solution of this problem is to entitle producers of conventional or organic foodstuff to claim these descriptions despite contamination with GMOs and defining as proportionate requirements relating to co-existence those which make sure that the traces of GMOs – still regarded as adventitious, notwithstanding the claimed inevitability of impurities! – stay below the tolerance threshold (2.1.4 para. 1 Co-exRec). As a result the Commission ensures the interests of those consumers who want to obtain GMfood, but disregards any interest to choose between truly conventional or, in particular, truly organic and GM products with the objective of obtaining the former.

6 The Legal Situation for Genetically Engineered Food in Europe

6.2.2.3 Compliance with World Trade Law The Agreement Establishing the World Trade Organization (WTO) of 15.4.1994 [26] has substantial influence on food law via the Agreement on the Application of Sanitary and Phytosanitary Measures (SPS Agreement) and the Agreement on Technical Barriers to Trade (TBT Agreement) which were concluded within its framework and via their combination with the rules of the Codex Alimentarius Commission. Although the Commission claims on its website that the relevant rules of Community law are in accordance with the Community’s duties under world trade law [27], doubts have been voiced in this regard. The rules on the authorization of GM foods, which come under the ambit of the SPS Agreement which covers measures taken to protect human health, might be problematic because they apply to products which are only produced from a GMO and therefore do not contain any detectable GM material (cf. art. 4 para. 2, 3 para. 1, 2 No. 10 GMFFR) [28]. Similarly, the labeling requirements for such products might be in conflict with the requirements of the TBT Agreement which covers requirements other than for health reasons [29]. The panel adjudicating the complaints brought by the USA, Canada, and Argentina on the alleged de facto moratorium of the EC on reaching final decisions regarding the approval of biotech products between 1998 and 2003 in its interim report [30] found the EC to have processed the applications with “undue delay” [31], thereby breaching art. 8 and Annex C of the SPS Agreement. It did not examine the underlying legal provisions, i.e. the predecessors of the law currently in force, with a view to their conformity with WTO law, but only examined the application procedures. Therefore the question of conformity with WTO law of the current legal regime has not been answered. It also remains unresolved whether the dispute settlement mechanism is the (most) appropriate place to determine the relationship between world trade law and environmental questions. 6.2.3 Competent Authorities in the Member States

The most important competent national authority in Germany is the Federal Office for Consumer Protection and Food Safety (Bundesamt für Verbraucherschutz und Lebensmittelsicherheit – BVL). According to art. 1 of the ECBI Act it deals with applications under art. 5, 6 para. 2, art. 9 para. 2, art. 17, art. 18 para. 2, art. 21 para. 2 of the GMFFR and provides the various assessments under art. 6 para. 3 lit. b and c, para. 4 sentence 3 and art. 18 para. 3 lit. b and c, para. 4 sentence 3 of the GMFFR. It issues requests under art. 10 para. 1 sentence 1, art. 22 para. 1 sentence 1 of the GMFFR and is entitled to suspend an authorization in whole or in parts in accordance with art. 34 of the GMFFR read in conjunction with art. 54 of the Basic Regulation.

147

148

6.2 The Law Applicable to Genetically Modified Food

6.2.4 Relation to Directive 2001/18/EC of the EP and the Council

Like its predecessor in relation to the Deliberate Release Directive 1990, the GMFF Regulation provides for the coordination with the Deliberate Release Directive 2001. Art. 5 para. 5 of the GMFFR requires an applicant in the case of GMOs or food containing or consisting of GMOs to include in the application either the complete technical dossier supplying the information required by Annexes III and IV to the Deliberate Release Directive 2001 and information and conclusions about risk assessment conducted in accordance with the principles set out in Annex II to the Deliberate Release Directive 2001 or, when placing of the GMO on the market has been authorized under part C of Deliberate Release Directive 2001, a copy of the authorization decision, and a monitoring plan for environmental effects conforming with Annex VII to the Deliberate Release Directive 2001, including a proposal for the duration of the monitoring plan which may be different from the proposed period for the consent. In this context, reference is also made to the environmental safety requirements referred to in the Deliberate Release Directive 2001 which shall apply to the evaluation provided for in art. 6 para. 3 of the GMFFR (art. 6 para. 4 GMFFR). As a result, the requirements of the Deliberate Release Directive 2001 relating to specific environmental risk assessment have their equivalents under the GMFF Regulation. Therefore, art. 5 para. 5 subpara. 2 of the GMFFR – in accordance with art 12 para. 1 Deliberate Release Directive 2001 – provides that in such cases art. 13 to art. 24 Deliberate Release Directive 2001 shall not apply [32]. 6.2.5 Supplementary National Provisions in German Law: The ECBI Act, the Biotechnology Act, and the Novel Foods and Food Ingredients Instrument 6.2.5.1 General Rules for Genetically Modified Food and Feed The rules necessary to implement as well as supplement EC law in Germany are contained in the EC Biotechnology Implementation Act and in the Biotechnology Act. § 1 of the ECBI Act provides for the competence of the Federal Office for Consumer Protection and Food Safety (BVL) to act as the competent authority vis-à-vis the applicants, the authorities of the other Member States, and the Commission. It is worth mentioning here that § 1 para. 2 of the ECBI Act gives it the power to suspend authorizations in accordance with art. 34 of the GMFFR and art. 54 of the Basic Regulation. The supervision relating to the compliance with the GMFF Regulation, the GMFFTraceLabel Regulation and Regulation 1946/2003 of the actors in the market place, falls into the competence of the appropriate Land authority (§ 4 para. 1 ECBI Act), which may prohibit the placing on the market of any product if the relevant authorization is suspended or lacking (§ 4 para. 2 ECBI Act). It may also take interim protective measures provided for in art. 54 para. 1 sentence 1 of the Basic Regulation, including prohibiting the placing on the market of a relevant product (§ 4 para. 3 ECBI Act).

6 The Legal Situation for Genetically Engineered Food in Europe

The substantive provisions are primarily those of the GMFF Regulation which is directly applicable according to its nature. Additional provisions dealing with the substance of the law concerning genetically modified food or feed are to be found in the Biotechnology Act, mainly in its Third Part (§§ 14 et seqq.). §§ 14 et seqq. of the Biotechnology Act deal with the release and putting on the market of genetically modified organisms or products to transpose the provisions of the Deliberate Release Directive 2001. Appropriately, § 14 para. 2 of the Biotechnology Act – in accordance with art. 12 Deliberate Release Directive 2001 – excludes GMOs as or in products for which equivalent sectoral legislation exists – for example genetically modified food and feed – from the scope of application of the largest part of those provisions, with the exception of the provisions on the register of locations (§ 16a Biotechnology Act) and on the dealing with products in the market place (§ 16b Biotechnology Act). § 16b of the Biotechnology Act transposes the new art. 26a of the Deliberate Release Directive which was introduced by art. 43 of the GMFFR (cf. Section 6.2.2.2). It establishes a duty to avoid any not irrelevant impairment of objects which must be protected according to § 1 no. 1 and 2 of the Biotechnology Act, which include the possibility of producing and marketing conventional or organic food and feed (§ 16b para. 1 Biotechnology Act). This duty is fulfilled by using good agricultural practice (§ 16b para. 2 Biotechnology Act), which is described, nonexhaustively, in § 16b para. 3 of the Biotechnology Act. § 16b para. 4 of the Biotechnology Act provides for the qualities any person dealing professionally with products consisting of or containing GMO must have, namely the reliability, knowledge, abilities, and equipment necessary to fulfill the duty under § 16b para. 1 of the Biotechnology Act. § 16b para. 5 of the Biotechnology Act imposes a duty on everyone placing on the market a relevant product to provide product information which communicates any provision in the authorization detailing the way the product must be dealt with and advice on how to fulfill the duties under § 16b paras 1 to 3 of the Biotechnology Act. The provisions of the Novel Food and Food Ingredients Instrument (henceforth: NFI) are relevant only with regard to negative labeling. They are dealt with in the next section.

6.2.5.2 Availability of Negative Labeling of Foodstuffs Made Without Using Procedures of Genetic Engineering The provisions of the GMFF Regulation, like those of the Novel Food Regulation, do not contain a prohibition of negative labeling of products made without the use of genetic engineering. The Novel Food Regulation even states expressly in its recital 10 that such statements may be made (cf. on this and the concept of negative labeling see Section 6.2.2.1). Conditions of negative labeling The relevant foodstuff may neither consist of nor be produced from genetically modified organisms (§ 4 sentence 1 no. 1 NFI) nor be produced with the help of such material or of auxiliary material which in turn has been extracted from genetically modified organisms (§ 4 sentence 1 no. 2 NFI). If

149

150

6.2 The Law Applicable to Genetically Modified Food

parts of a genetical modification enter into a food unintentionally and in inevitable traces, this does not prevent negative labeling according to § 4 sentence 2 of the NFI. To use the indeterminate legal term “inevitable traces” rather than defining a marginal value for the maximum contamination permitted is problematic, however – if we compare this with the regulation of the threshhold value for the labeling according to art. 12 para. 2, 24 para. 2 of the GMFFR (Section 6.2.1.5, Conditions), it is possible to imagine cases where, because of contamination above 0.9%, the rule of art. 12 para.2 , 24 para. 2 of the GMFFR no longer applies, but the relevant product may – if the necessary inevitability is given – still be labeled “ohne Gentechnik” (“no use of genetic engineering techniques”) according to § 4 sentence 2 of the NFI. How these valuation discrepancies, which seem simply inexplicable to the consumer, will be dealt with by the legislator or the courts (for example by presuming that only contamination below 0.9% can be deemed inevitable, which would lead to an improvement in legal certainty but rather support the introduction of a precise marginal value in § 4 sentence 2 of the NFI), will remain to be seen. If the food comes from an animal this animal must not have been fed with feed, feed additives, or drugs within the meaning of art. 2 of the Drug Act, that have been produced with the help of genetic engineering. Here, those drugs are excluded which have been given for therapeutic or prophylactic purposes and which could not be replaced by an equivalent conventional drug, § 4 sentence 3 of the NFI. § 5 contains several of additional requirements for labeling. § 5 sentence 1 NFI demands proof of the requirements contained in § 4 sentences 2 and 3 of the NFI, without which the corresponding labeling is unlawful (§ 5 sentence 2 NFI). § 5 sentence 3 of the NFI refers to the standard example (“especially”) of a binding statement of producers or suppliers, rendering other forms of appropriate proof (at least theoretically) possible. § 6 NFI also increases these requirements by allowing for prohibition of the labeling when the person responsible is unable to dispel reasonable doubts about whether the requirements are met. The element of negative labeling Both the labeling of the relevant products and the advertising of them (cf. § 4 sentence of the 4 NFI, which makes the rules contained in § 4 sentences 1 to 3 of the NFI applicable to advertisments) may – to protect the consumer against a plurality of terms which may sound similar but differ as regards content – exclusively use the term “ohne Gentechnik” (“no use of genetic engineering techniques”; § 4 sentence 1 NFI). All other terms are unlawful.

6.2.5.3 The Element of the Label Art. 17b para. 1 of the Biotechnology Act imposes a duty to label any product consisting of or containing GMO as “This product contains genetically modified organisms (Dieses Produkt enthält genetisch veränderte Organismen)” unless any GMO content is adventitious or technically unavoidable and below the threshold value defined by the relevant European legislation.

6 The Legal Situation for Genetically Engineered Food in Europe

6.2.5.4 Rules on Criminal Offences and Misdemeanors Art. 45 of the GMFFR requires the member states to lay down the rules on penalties applicable to infringements of the provisions of the GMFF Regulation. In Germany, this has been done in § 6 and § 7 of the ECBI Act. § 6 para. 1 of the ECBI Act makes it a criminal offence to place products on the market or to use them without the necessary authorization according to art. 4 para. 2 and art. 16 para. 2 of the GMFFR. If the life or body of other people, their property of high value, or important ecosystems are endangered in committing the offence, § 6 para. 1 of the ECBI Act provides for mandatory imprisonment of between three months and five years. § 6 para. 4 of the ECBI Act penalizes attempts and § 6 paras 5 to 7 of the ECBI Act provides for the relevance of negligence in committing the penalized acts. § 7 para. 1 of the ECBI Act makes it a misdemeanor to deliberately or negligently breach a number of duties resulting from the GMFF Regulation, in particular concerning notifications, monitoring, and labeling. In these cases, fines up to 50,000 € may be imposed (§ 7 para. 4 ECBI Act).

References 1 Regulation (EC) No 258/97 of the EP and of the Council of 27 January 1997 concerning novel foods and novel food ingredients, OJ (EC) 1997, No 43/1. 2 Halsbury’s Laws of England, vol. 18 (2), 2000; supplements 2001–2004. 3 Commission Regulation (EC) No 50/2000 of 10 January 2000 on the labelling of foodstuffs and food ingredients containing additives and flavorings that have been genetically modified or have been produced from genetically modified organisms, OJ (EC) 2000, No L 6/15; repealed by art. 37 Regulation 1829/2003 (see note 8). 4 (EC) No 1813/97 of 19 September 1997 concerning the compulsory indication on the labelling of certain foodstuffs produced from genetically modified organisms of particulars other than those provided for in Directive 79/112/EEC (OJ (EC) 1997, No L 257/7). 5 Council Regulation (EC) No 1139/98 of 26 May 1998 concerning the compulsory indication of the labelling of certain foodstuffs produced from genetically modified organisms of particulars other than those provided for in Directive 79/112/EEC (OJ (EC) 1998, No L 159/4).

6 Council Directive No 90/220/EEC of 23 April 1990 on the deliberate release into the environment of genetically modified organisms, OJ (EC) 1990, No L 117/15; repealed by art. 36 Directive No. 2001/18/ EC (see note 9). 7 COM (1999) 719, on the internet at http:// www.europa.eu.int/comm/dgs/health_ consumer/library/pub/pub06_en.pdf. See on this topic Horst/Mrohs, Das Europäische Lebensmittelrecht am Scheideweg – Das Weißbuch der Kommission zur Lebensmittelsicherheit, ZLR 2000, p. 125. 8 OJ (EC) 2003, No L 268/1. 9 Directive 2001/18/EC of the European Parliament and the Council of 12 March 2001 on the deliberate release into the environment of genetically modified organisms, OJ (EC) 2001, No L 106/1, (henceforth: Deliberate Release Directive 2001) repeals the Deliberate Release Directive 1990 (see note 6). 10 OJ (EC) 2003, No L 268/24. 11 Regulation (EC) No 178/2002 of the European Parliament and of the Council of 28 January 2002 laying down the general principles and requirements of food law, establishing the European Food Safety

151

152

References Authority and laying down procedures in matters of food safety, OJ (EC) 2002, No L 31/1. 12 Council Decision 1999/468/EC of 28 June 1999 laying down the procedures for the exercise of implementing powers conferred on the Commission, OJ (EC) 1999, No L 184/23. 13 The analogous rule concerning feed may be found by adding 12 to the number of the relevant provision concerning food; in this context, it is art. 16 para. 2 GMFFR. 14 Commission Regulation (EC) No 641/2004 of 6 April 2004 on detailed rules for the implementation of Regulation (EC) No 1829/2003 of the European Parliament and of the Council as regards the application for the authorisation of new genetically modified food and feed, the notification of existing products and adventitious or technically unavoidable presence of genetically modified material which has benefited from a favourable risk evaluation, OJ (EC) 2004, No L 102/14, (henceforth: Regulation 641/2004/EC). 15 Cartagena Protocol on Biosafety to the Convention on Biological Diversity (U.N. Doc. UNEP/CBD/ExCOP/1/3, reprinted in 39 I.L.M. 1027 (2000), available on the internet at http://www.biodiv.org/biosafety/ protocol.asp), Annex II. [15*]The numerous occurrences of this situation in the context of GMOs led the Member States to argue for a review of the Comitology Decision to change this situation. The new draft nevertheless does not contain such a change, of. Amended proposal for a Council Decision amending Decision 1999/468/EC laying down procedures for the exercise of implementing powers conferred on the Commission 10126/1/06 REV 1. This is not likely to change. 16 Cf. the information on the results of food monitoring at http://www.transgen. de/einkauf/ueberwachung/. 17 Similar requirements in relation to feed are contained in art. 25 of the GMFFR. 18 Commission Regulation (EC) No 65/2004 of 14 January 2004 establishing a system for the development and assignment of unique identifiers for genetically modified organisms, OJ (EU) 2004, No L 10/5.

19 Gesetz zur Durchführung von Verordnungen der Europäischen Gemeinschaft auf dem Gebiet der Gentechnik (EGGentechnik-Durchführungsgesetz) vom 22. Juni 2004, BGBl. I S. 1244, henceforth ECBI Act. 20 Verordnung zur Durchführung gemeinschaftsrechtlicher Vorschriften über neuartige Lebensmittel und Lebensmittelzutaten und über die Kennzeichnung von Erzeugnissen aus gentechnisch veränderten Sojabohnen und gentechnisch verändertem Mais sowie über die Kennzeichnung ohne Anwendung gentechnischer Verfahren hergestellter Lebensmittel = Statutory Instrument for the Implementation of Community Legislation concerning Novel Foods and Food Ingredients and the Labelling of Products made from Genetically Modified Soya Beans and Genetically Modified Maize as well as the Labelling of Foodstuffs which have been Produced Without Means of Genetic Engineering (Novel Foods and Food Ingredients Instrument – NFI), as re-published 14.02.2000 (Federal Law Gazette 2000, part. I, p. 123). 21 OJ (EU) 2003, No L 287/1. 22 Joint cases T-366/03 and T-235/04, Land Upper Austria and Republic of Austria/ Commission, ZLR 2005, p. 716. 23 Ibidem, Nos 66–67. 24 Commission Recommendation of 23 July 2003 on guidelines for the development of national strategies and best practices to ensure the coexistence of genetically modified crops with conventional and organic farming (notified under document number C(2003) 2624) (2003/556/EC), OJ (EU) 2003, No L 189/36. 25 Ohler, ZLR 2005, 732 (737). 26 1867 UNTS 154, 33 ILM 1144 (1994). 27 Questions and answers on the regulation of GMOs in the European Union, p. 17 – 18, available at http://www.europa. eu.int/comm/food/food/biotechnology/ gmfood/qanda_en.pdf. 28 Fuchs/Herrmann, Die Regulierung genetisch veränderter Lebensmittel im Lichte aktueller Entwicklungen auf europäischer und internationaler Ebene, ZLR 2001, 789 (807). 29 Fuchs/Herrmann, op. cit., 805 et seq., arguing that different production meth-

6 The Legal Situation for Genetically Engineered Food in Europe ods are not enough to justify differential treatment. The opposite result is reached by Sander/Sasdi, Welthandelsrecht und “grüne” Gentechnik – Eine transatlantische Auseinandersetzung vor den Streitbeilegungsorganen der WTO, EuZW 2006, 140 (143 et seq.) who argue that consumer preferences are a factor in determining whether products are “like” and that the scepticism of European consumers warrant the labelling provisions. 30 WT/DS291/INTERIM, WT/DS292/INTERIM, WT/DS293/INTERIM. The interim report was leaked and an edited version is available in two parts at www.foei. org/media/2006/WTO_report_descriptive. pdf and www.foei.org/media/2006/WTO_ report_findings.pdf, the latter containing the Conclusions and Recommendations at p. 1030–1050; on the wider legal and

political implications of this dispute see Winickoff/Jasanoff/Busch/Grove-White/ Wynne, Adjudicating the GM Food Wars: Science. Risk, and Democracy in World Trade Law. Yale Journal of International Law 30.1 (Winter 2005), 81 – 123. 31 In the literature it had been argued that given the necessary requirements of appropriate studies into the long term effects of GM-products the time used by the Commission did not constitute an “undue delay”, cf. Sander/Sasdi, op. cit, 143; cf. also Christoforou, The regulation of genetically modified organisms in the European Union: the interplay of science, law and politics, Common Market Law Review 2004, 637 (699). 32 Art. 17 para. 5 and art. 18 para. 4 GMFFR contain analogous provisions in relation to feed.

153

Part III Methods of Detection

7 Detection of Genetic Modifications – Some Basic Considerations Knut J. Heller

7.1 The Conversion of Genetic Information from DNA to Phenotypes

The genetic information of all organisms, whether uni- or multicellulan is stored within DNA in the form of a specific sequence of just four different nucleotides. This information determines functional traits as a result of two consecutive, fundamental, biological processes – transcription and translation (Fig. 6.1). In the first step – transcription – RNA is formed. This single-stranded molecule is – with two exceptions – a one-to-one copy of one strand of the DNA. The first exception is that the backbone of RNA contains ribose instead of deoxyribose as in DNA. The second exception is that wherever DNA contains the nucleobase thymine in its sequence RNA contains uracil instead. Three different forms of RNA are synthesized – transfer-RNA (tRNA), ribosomal RNA (rRNA), and messenger RNA (mRNA) (Fig. 6.2). All three types of RNA are needed for protein synthesis, which is the second fundamental biological step – translation. Only the mRNA, which is used as a template for protein synthesis, determines directly the amino acid sequence of proteins; tRNA and rRNA are helper molecules needed as constituents of the functional machinery of protein synthesis. Proteins serve different functions inside or outside the cell – as structural elements, regulators, transporters, and enzymes. The last two, especially, are involved in the synthesis of other high-molecular-weight structural components of the cell, the lipids and polysaccharides. As a result of the action of structural elements and of enzymes, the cytoplasm of a cell contains soluble, insoluble, high-molecular-weight, and low-molecular-weight substances, which reflects the interaction between environmental conditions (chemical and physical factors) and endogenous cellular factors (growth phase, stage of differentiation, etc.). Structural and functional elements contribute to the measurable properties of a cell, which are called phenotypes. A phenotype, therefore, is a direct reflection of a genotype.

158

7.2 DNA, Protein, and Phenotypes as Targets for Detection Assays

5’..A CGG ATA GCA TGG AAT CGA CAG TTG CAG G..3’ 3’..T GCC TAT CGT ACC TTA GCT GTC AAC GAC C..5’

DNA: Transcription

..... ↓

↓

N-term. ...R

Q...C-term.

Translation Protein

...

5’..A CGG AUA GCA UGG AAU CGA CAG UUG CAG G..3’

mRNA

...

Fig. 7.1 The flux of genetic information from DNA to protein. DNA consists of the four nucleobases adenine (A), guanine (G), cytosine (C), and thymine (T), which form two anti-parallel, complementary strands, the polarity of which is determined by their direction of biosynthesis and is indicated by their 5 and 3 ends. The backbone of the strands contains deoxyribose. mRNA is synthesized using the lower DNA strand as a template. It consists of one strand formed of the four nucleobases adenine (A), guanine (G), cytosine (C), and uracil

.....

(U). The polarity of RNA is also determined by its direction of biosynthesis and is indicated by its 5 and 3 ends. The backbone of the strand contains ribose. Protein is synthesized using mRNA as a template. A sequence of three nucleotides codes for the amino acids (e.g. arginine (R), isoleucine (I), alanine (A), tryptophan (W), asparagine (N), glutamine (Q), leucine (L)) which form one peptide strand. The polarity of protein is determined by its direction of biosynthesis and is indicated by its N-terminal and C-terminal ends.

7.2 DNA, Protein, and Phenotypes as Targets for Detection Assays

With regard to genetically modified organisms – be they modified by natural mutation or by genetic engineering – information about the genotype of the organisms can be obtained on all levels of the process of conversion of genetic information into structural and functional traits – on the level of DNA, on the level of RNA, on the level of protein, on the level of cellular non-nucleic acid, nonprotein substances, and on the level of phenotypes (see also Chapter 13). Conclusions about genetic modification that can be drawn from the detection on the different levels may vary substantially, however. This can be illustrated by three examples. 1. Cells of a bacterial strain, which are normally unable to degrade starch and to use the sugar moieties for growth because of lack of suitable enzymes, have the phenotype “growth on starch as sole carbon source”. The conclusion is rather precise – the cells must have acquired at least one gene encoding a secreted starch-degrading enzyme. This proves that a new gene has been introduced into the cells. The gene, the mRNA, the degrading enzyme, and the degradation products of the starch may all serve as substances on which a detection assay may be established. 2. Soy bean plants which are normally sensitive to a particular herbicide are resistant to the herbicide. Different explanations are possible. The plants have – as a result of genetic engineering – obtained a gene encoding a herbicidedegrading enzyme, or the plants have undergone spontaneous mutations which either prevent uptake of the herbicide into the plant or alter the target of the herbicide within the plant cells. To exclude the possibility of spontaneous

7 Detection of Genetic Modifications – Some Basic Considerations

Fig. 7.2 Transformation of the genetic information of DNA into phenotypes. DNA is transcribed into three species of RNA – transfer-RNA, messenger-RNA, and ribosomal-RNA. Messenger-RNA is translated into proteins, which serve as structural proteins, transporters, enzymes, and regulatory proteins inside the cell. The last three type of protein are involved in the synthesis of lipids and carbohydrates and in the production of metabolites. The cellular concentration of other

solutes is adjusted mainly by transporters and regulators. The sum of all physical and functional elements of a cell determines its phenotype. Solid arrows indicate transformation processes in which the upper molecule serves as a template for the synthesis of the lower molecule. Thus, the sequence of the upper molecule can, in principle, be deduced from the sequence of the lower molecule. Dotted arrows indicate transformation processes where this deduction is not possible.

mutations, different options for confirmation of genetic modification are possible. The gene encoding the enzyme, the mRNA transcribed from the gene, the protein expressed, or the herbicide-degradation products specific for the enzyme used may be detected by suitable assays. 3. Cells of a bacterial strain which normally are able to grow on lactose as sole carbon source turn into a lactose-negative phenotype, i.e. they are no longer capable of utilizing lactose. Different explanations are possible. The bacteria have acquired – through genetic engineering or spontaneous mutation – defects in genes encoding lactose-transport proteins or in genes encoding enzymes necessary for lactose or sugar metabolism. Because no specific degradation products, proteins, or mRNAs are present for analysis, the only way to exclude spontaneous mutation is to analyze the gene loci possibly affected by genetic modification. As will be discussed later as an example of “self-cloning”, however, even determination of the DNA sequence of the gene affected may not be sufficient to distinguish between spontaneous mutation and genetic engineering.

159

160

7.2 DNA, Protein, and Phenotypes as Targets for Detection Assays

When designing assays for the detection of modifications introduced by genetic engineering, the validity of the assays must be considered. In example 1, determination of the phenotype may be a convincing assay. In example 2, however, determination of the phenotype is of no value – a valid assay must be based on determination of specific degradation products, enzymes, mRNA, or DNA. In example 3, only assays based on the determination of specific DNA sequences will yield reliable results. The degeneration suffered by genetic information during conversion into structural and functional traits must also be considered. The only biological process resulting in an exact 1:1 copy of the DNA is replication. Transcription usually yields 1:1 copies of the transcribed DNA regions (Fig. 6.1). Nontranscribed DNA regions will never show up at the RNA level, however. Furthermore, especially in higher organisms, the primary transcript produced by the step of transcription may be altered by an editing process in which specific sequences – called introns – are deleted from the primary RNA transcript to form the actual mRNA. During translation, further information is lost or obscured. This has several consequences. 1. As within the process of transcription, only part of the mRNA is translated into protein. The regions translated are called open reading frames. 2. A frame of three mRNA nucleotides (a codon) is required to encode one amino acid (Fig. 6.1). Three nucleotides out of four offer the possibility of forming 64 different combinations. Because only 20 amino acids are used for protein synthesis, however, several codons code for the same amino acid – the amino acids serine, leucine, and arginine are each encoded by six different codons. Only methionine and tryptophan are encoded by one codon each. The amino acid sequence of a protein is, therefore, only partly suitable for deducing the nucleotide sequence of the mRNA. 3. Many proteins are subject to post-translational processing. One result of this processing may be removal of part of the polypeptide chain. It is obvious that no information on the mRNA or DNA sequence of the removed parts can be deduced from the mature protein. Whereas sequence analyses of RNA and protein enable some conclusions about the DNA sequence, analyses of other constituents of the cell (lipids, carbohydrates, metabolites, and solutes; Fig. 6.2) and of the phenotypes do not provide any clues about the DNA sequence. Although, as shown above, such analyses may indicate the presence of a genetic modification, no information is obtained about the true nature of the modification. Thus, the ideal target molecule for detecting genetically engineered modifications is the DNA. This is all the more true because the most sensitive, rapid, and powerful analytical methods are available for DNA (Chapter 8). Introduction of a foreign gene into the DNA of an organism can, furthermore, be detected unambiguously only at the DNA level. The presence, e.g., of a bacterial enzyme in a plant extract may be a result of contamination. As long as the enzyme has not been altered by post-translational processes specific either for bacteria or for plants, the protein itself will not reveal whether it has been expressed in a plant or in a bacterium. The corresponding gene, cloned in a vector construct, transformed into

7 Detection of Genetic Modifications – Some Basic Considerations

the plant, and integrated into the plant DNA, can always be identified as a foreign gene, however, because it is flanked by DNA sequences which do not naturally flank this gene. An assay targeting the fusion sites of two DNA sequences of different origin, therefore, unambiguously identifies a product of a genetic engineering process – unique DNA sequences which are exclusively present in the specific recombinant DNA construct and nowhere else.

7.3 Food-grade Modifications

The considerations in the previous section are especially important for detection of very minor modifications in bacteria, the organisms for which the most advanced genetic engineering methods are available. In bacteria, foreign DNA is normally introduced via plasmids. It may subsequently be inserted directly into the chromosomal DNA of the organism at an exactly predetermined position, with concomitant loss of all unnecessary vector sequences (see Fig. 12.1). The modification may not even involve introduction of foreign DNA, but, merely rearrangement of the existing DNA, a process known as “self-cloning”. These minor modifications or the introduction of foreign DNA without any vector sequences (assuming the foreign DNA comes from a related, food-grade organism) are so-called “food-grade” modifications. The concept of food-grade modifications demands that the exact DNA sequence of the entire modification is known, that no antibiotic resistance genes – often used as selection markers for introduction of foreign DNA into a host cell – remain in the genetically modified organism, and that when plasmids are introduced they must have a narrow host range and be nonconjugative and nonmobilizable, i.e. the chances of transfer of the plasmids to other organisms are extremely low. The idea of a “food-grade concept” stems from Council Directive 90/219/EEC on the contained use of genetically modified microorganisms. In Annex I of this directive, self-cloned nonpathogenic naturally occurring microorganisms fulfilling the criteria of Group I for recipient microorganisms are excluded from the directive. The criteria for classifying microorganisms in Group I are listed in Annex II of the directive and involve some of the above mentioned prerequisites for classifying organisms as “food-grade modified”. The reason self-cloned microorganisms were excluded from directive 90/219/EEC was that such organisms are basically indistinguishable from their nonmodified counterparts and, thus, pose no larger risk than these. It must be noticed, however, that self-cloned microorganisms are not excluded from Directive 2001/18/EC on deliberate release into the environment of genetically modified organisms and, thus, not from Regulation EC No. 1829/2003 on genetically modified food and feed. Modifications in bacteria may, in the extreme, involve just the deliberate replacement of one nucleotide by another. Although such minor modifications are indistinguishable from naturally occurring mutations they will be subject to “procedure-related labeling”, because they have been constructed by genetic engineering (Chapter 6, Section 2.1.5). Detection methods capable of detecting such minor al-

161

162

7.4 Detection of Unknown Modifications

terations – DNA sequencing or high-sensitivity hybridization (Chapter 9) – must be developed. They will, however, only reveal the presence of the specifc modification, which could also have resulted from a natural mutation. Only with the knowledge that somebody constructed this modification will it and the corresponding food be classified as genetically engineered.

7.4 Detection of Unknown Modifications

It goes without saying that unknown modifications of the kind described at the end of Section 7.3 can never be detected as modifications caused by genetic engineering. In principle this is true for all deliberate modifications produced by self-cloning techniques. Only if a substantial piece of foreign DNA is introduced can the piece be identified, because its unique sequence is not normally present in the organism. Although self-cloning techniques are readily available for bacteria, these organisms are currently not a focus in the development of detection methods, because no food containing living genetically engineered bacteria has yet been admitted. For plants, the situation with regard to the detection of unknown modifications is somewhat more promising. For a foreign gene to be expressed in a plant it must, at least, be fused to transcription signals which are recognized and employed by the plant cell machinery. The number of suitable transcription elements is limited and can easily be used for screening for unknown modifications (Chapter 10). Because the method relies on known elements, however, it is obviously not one hundred percent safe. To cut a long story short, even considering all the highly sophisticated methods for DNA analysis currently in existence one must conclude there is no reliable method capable of detecting any unknown modification in any given food.

8 DNA-based Methods for Detection of Genetic Modifications Ralf Einspanier

8.1 Introduction

The accelerated development of genetically modified organisms (GMOs) during the past ten years has raised a new set of questions about the release and traceability of such GMOs and their possible adverse effects on the safety of both the environment and the consumer. When genetically modified crops were recently introduced commercially, it seemed as though reliable recognition of such transgenes would inevitably become essential. Today, the main source of any novel genetic alteration that may be found in food is genetically modified plants and microorganisms. Although transgenic farm animals have been considered for specialized pharmaceutical production, they have not been introduced for large-scale agricultural production, except for aquaculture. It was considered that, in addition to food products, animal feed would be the major source of materials derived from transgenic plants. Identification of GMO-fed animals and elucidation of the safety of so-called “secondary products” will surely lead to many very demanding technical problems. Today the specific analysis of animal-derived food products (meat, milk, eggs) produced with GMOs seems to be technological impossible and is, consequently, not currently demanded by governmental regulations. If new transgenic strategies, for example chloroplast transformation, are implemented commercially, however, or new biochemical methods with yet inconceivable sensitivity are introduced, it seems likely that close observation of any such end product will become mandatory. Currently, because only limited scientific data are available in relation to proposed biological effects of GMO food and feed on the consumer organism and/or environment, the need for continued research is clear. Potential horizontal gene transfer among microorganisms has been controversially discussed as a possible mechanism of spread of novel genetic material into the environment, e.g. soil and rumen (Nielsen and Townsend 2004). If, ultimately, this occurs, any route by which genetic modification may be spread and appear in the environment must be identified and followed. The specific monitoring of transgenic products will,

164

8.2 Recent DNA Methodology

moreover, become obligatory to comply with national or international labeling regulations and, as an important future objective, to identify any complex metabolic interactions. Because of its remarkable chemical stability DNA has been isolated from almost all types of organic tissue (Pääbo 1993; Hoss 1995). Almost unlimited access to DNA as a result of multiplication of nucleic acids by use of the polymerase chain reaction (PCR) amplification technique (Saiki et al. 1985) has made this DNA-based method the most favored technique for GMO analysis. Compared with established protein-based detection methods (Lipp et al. 2000, van Duijn et al. 2002), this nucleic acid technology has the major advantage that low detection limits (< 1%) are achieved very reliably. In comparison with other methods (e.g. protein-ELISA), PCR is currently the technique of choice for monitoring GMOs in nucleic acid material isolated from highly processed foodstuff (Hemmer et al. 1998, Quirasco et al. 2004). Any GMO-detection method should be selected initially on the basis of performance criteria such as its fields of application and its limitations, however (Bertheau et al. 2002; Terry et al. 2002). It is the exponential amplification of DNA that results in the exquisite sensitivity of the PCR method, and this is an especially important prerequisite if GMO analyses are to be seen as reliable, controlled, and available under certified working conditions in all laboratories in which transgenic samples are examined. As a result of these advances, several programs have been established to ensure the high proficiency demanded of analytical laboratories. The programs include the food analysis performance-assessment scheme (FAPAS), which operates under international harmonized protocols (ISO, IUPAC, AOAC), the intention being to develop DNA-based standard methods for reliable monitoring of GMO materials in food and feed. Finally, to meet the requirements of rapidly growing EU legislation several validation studies are currently being performed (Bonfini et al. 2002; Miraglia et al. 2004). The detection methods used to identify genetic material derived from genetically modified organisms are reviewed below, with particular emphasis on the tracing of transgenic crops.

8.2 Recent DNA Methodology

The monitoring, detection and ultimate quantification of GMOs in food and feed samples by use of DNA techniques follows the more or less ubiquitous sequence of sampling, nucleic acid extraction, amplification, detection, and quantification and scientific evaluation of results (Fig. 8.1). Clearly, each of these steps has its own limitations, but the extremely complex starting materials, in particular, may require treatment on individual basis. The final conclusion is directly dependent on proper selection of valid methods in accordance with internationally harmonized protocols. Reviews have been published by Anklam et al. (2002), Kuiper (1999), and Holst-Jensen and Berdal (2004).

8 DNA-based Methods for Detection of Genetic Modifications

Crops Food Feed Animal samples

Fermented food

(cheese, bread, beer, wine)

Highly processed food (oil, lecithin, sugar)

(blood, meat, milk, egg, feces)

Food additives (enzymes, vitamins, flavour)

DNA - Extraction

Fig. 8.1 General GMO identification scheme providing the major steps from sample collection until the final judgment. Each of the indicated steps must be evaluated in detail and finally proved by conducting labor-intensive international trials. Mandatory laboratory methods are released on the basis that, in principle, they provide reliable means of detecting genetic modifications of food or feedstuffs.

Gene - Selection + Amplification Detection + Quantification Methods Result Assessment + Decision

8.2.1 Sampling Procedure

The most essential prerequisite for subsequent DNA analysis is representative sampling that will guarantee a statistically secure conclusion. Because of the great heterogeneity of highly diverse food material, it has been necessary to develop special sampling plans (Gilbert 1999). As a logical consequence, the outcome of subsequent analytical methods is only as good as the quality of sampling. Two possible approaches are often discussed, and either should lead to an adequate sampling plan: • to take a large sample with further subsampling, or • to take multiple samples. In addition, the particle size and distribution of the raw material must be taken into account, and the time at which samples are taken within the production process. Careful attention to prevent contamination has led to essential physical precautions being taken when handling any transgenic material. From sampling to laboratory analysis, aerosols and polluted equipment and consumables must be excluded. From a practical standpoint, authentic reference materials are available for selected transgenes (e.g. Bt 176 maize), although international standards and DNA procedures must be developed and provided for each GMO and for food and processed food individually. 8.2.2 Extraction and Purification of DNA

By taking advantage of the ubiquitous presence of DNA genetic material in every organism, all transgenic material will be identified if residual, extractable DNA is present and the gene sequence sought is known. The suitability of different meth-

165

166

8.3 Specific Detection of Genetic Material

ods for sample extraction and DNA purification for material from different sources must therefore be considered. Isolation and purification of probable GMO DNA from samples of different origin are the initial key steps in the whole procedure. Hence, individual extraction procedures that lead to a wide variety of purification procedures form a vital part of the process. Typically, samples are mechanically disrupted and/or treated enzymatically to dissolve DNA with the help of organic compounds (phenol, chloroform), detergents, enzymes (RNAse, protease), and chaotropic salts. Subsequent alcohol precipitation of the DNA results in its concentration and purification. In addition, high-throughput procedures can make use of ion exchange or silica chromatography, and paramagnetic particles which selectively bind nucleic acids under narrowrange salt, pH, and organic solvent conditions, thereby enabling capture, washing, and elution of DNA within the same cartridge. These extraction methods, which may be adapted to routine robotic applications, result in a highly standardized DNA purification process (with less cross-contamination and reduced individual sample variability yet similar DNA purity and hom*ogeneity). The method should, however, be selected to favor comparatively high-quality DNA despite, occasionally, lower yield. Indeed, a number of situations in which extraction of DNA has been limited (e.g. problematic matrices, for example soybean oil; Pauli et al. 1998) have now been successfully overcome by use of individually established procedures for difficult samples (Gryson et al. 2002).

8.3 Specific Detection of Genetic Material

The unique biochemical feature of nucleic acids is the occurrence of a highly specific and predictable interaction between complementary single-stranded DNA fragments. The formation of hydrogen bonds between the corresponding heterocyclic bases (A–T, G–C) results in the formation of a double-stranded complex between probe and target DNAs. Most of the following applications used to detect DNA are founded on the basic molecular interaction known as hybridization. The main prerequisite of any successful transgene analysis is an exact knowledge of the genetic modification within each GMO. Therefore, free access to detailed sequence information, not only of the modified gene but also of the flanking regions, is absolutely necessary for subsequent GMO analysis to be conducted, because unknown or cross-bred constructs are difficult or even impossible to detect. 8.3.1 DNA Hybridization-based Detection Technique (Southern Blot)

One landmark event in the characterization of nucleic acids was the development of a DNA:DNA hybridization immobilized on a solid support (Southern 1975). This procedure, known as “Southern blot”, entails size separation of DNA by gel electrophoresis followed by immobilization on a membrane and subsequent probe

8 DNA-based Methods for Detection of Genetic Modifications

hybridization and detection either by radiolabeling or by well-developed nonradioactive methods (e.g. chemiluminescence). Based on DNA:DNA hybridizations, generation of a specific signal is highly dependent on variable conditions, for example transfer efficiency, sequence hom*ology, buffer condition, temperature, and incubation time. Because of these limitations, this technique alone does not provide the necessary performance to detect the low-abundance events normally found in GMO material. Only single-copy gene-detection methods have proved suitable, using massive concentrations of native plant DNA (McCabe et al. 1997). Although this technique is still useful for elucidation of the flanking genomic areas of an integrated transgene, low sensitivity (>0.5 pg DNA) has been the main limitation. Southern blotting methods may support common DNA amplification methods (e.g. after PCR, see below) by verifying investigated DNA sequences by restriction enzyme digestion and subsequent hybridization to GMO-specific probes (restriction fragment-length polymorphism; RFLP; Sabelli 1998).

8.4 Nucleic Acid Amplification Methods using PCR

A frequent disadvantage of food inspection is the limited availability in the sample material of target molecules to be analyzed. When the requisite prior extraction procedures have been conducted, DNA material of low abundance can be enriched by introducing selective amplification reactions that take advantage of naturally occurring nucleic acid polymerization. The objective of this method is augmentation of trace amounts of distinct nucleic acids, enabling further characterization and quantification. 8.4.1 Conventional PCR

The polymerase chain reaction (PCR) is a relatively simple – but very effective – means of detecting minute quantities of DNA sequences. This technique enables exponential amplification of DNA in vitro, on the basis of the unique properties of the heat-stable Taq-DNA-polymerase. The recognition of specific short oligonucleotides (primers) hybridized on a single-stranded target DNA leads to subsequent DNA polymerization and selective amplification of previously known DNA fragments (Fig. 8.2). In general, one single reaction cycle comprises heat-denaturation, primer annealing, and an enzymatic elongation step; the result is an approximate doubling of the number of DNA molecules. Detailed descriptions and special technical hints for this widely used PCR technique have been described in a flood of publications. Reviews have been published by Innis et al. (1990) and Rapley (1998). Performing several (up to forty) cycles in succession leads to exponential accumulation of the desired DNA fragment (e.g. CryIA, pat, 35S) up to a detectable amount of the desired amplicon. In this way it may be possible to amplify every gene of interest

167

168

8.4 Nucleic Acid Amplifikation Methods using PCR 3´

5´

A. Denaturation B. Primer annealing C. Elongation

3´

5´

Cycling

Resulting Molecule Number 2n(=cycles) Fig. 8.2 General principle of the polymerase chain reaction (PCR). The cycle comprises three steps: (A) denaturation of doublestranded target DNA by heat separation of base-pair hydrogen bonds; (B) the forward and reverse primers anneal to their complementary single-stranded target; (C) subsequent 5 3

elongation of each primer by means of a heatstable DNA polymerase (Taq polymerase = green circle) generating a new double-stranded DNA. Each subsequent cycle will, in theory, double the initial number of DNA fragments and therefore enable exponential increase of starting DNA molecules.

(e.g. transgenes) from appropriately purified residual DNA. After each PCR the amount and specificity of the resulting amplicons must be verified by use of three common methods: • product length verification after electrophoretic separation in gels with nucleic acid-specific dyes intercalating in the double-stranded PCR product (e.g. ethidium bromide); • restriction enzyme digestion then electrophoretic separation and Southern blotting by means of target-specific hybridization probes using either radioactive or nonradioactive labeling; and • exact sequence determination by DNA sequencing. One of the earliest uses of standardized PCR was in medical research handling tissue biopsies; This led to the development of very reliable procedures under GLP (good laboratory practice) conditions. In addition to the well-known common PCR assay, several specialized modifications have been introduced during the past decade, including asymmetric, allele-specific, nested, multiplex, differential, and competitive PCR. Each of these methods has unique features that have been reviewed elsewhere (Rolfs et al. 1992). Hence, typical PCR methods may be adopted for GMO detection within food and feed. Methods suitable for analysis of PCR products include capillary gel electrophoresis coupled with laser-induced fluorescence detection (Garcia-Canas et al. 2004). Multiplex approaches capable of detecting up to seven genetically modified maize lines in one sample have recently been described as suitable for GMO monitoring (Matsuoka et al. 2001, 2002; Hernandez

8 DNA-based Methods for Detection of Genetic Modifications

et al. 2005). For example, a multiplex nested PCR assay has been commercialized which, it is claimed, prevents the occurrence of false-positive results (Biosmart Alin 1.0 GMO Screening System, Promega, WI, USA). GMO methods based on triprimer and competitive PCRs have been developed for detecting transgenic rice, soybean, and maize (Lee et al. 1998; Wurz et al. 1999; Hupfer et al. 2000). The introduction of PCR-ELISA has also resulted in the availability of individual procedures for rapid GMO screening (Brunnert et al. 2001). Within the last five years a remarkable selection of different PCR assays for detecting GMO DNA have been made available; these have been evaluated to determine limits of detection (LOD) and quantification (LOQ) (Holst-Jensen et al. 2003). Such putative quantitative PCR assays are based on end-point measurements and must always cope with the following restrictions: • end-point measurement of the performed PCR is expected to represent the exponential range of amplification; • doubtful detection and adequate amplicon quantification methods; and • laborious verification of each PCR product generated. To overcome such limitations, new real-time PCR techniques which generate reliable PCR data within several hours have recently been developed. 8.4.2 Real-time PCR

A novel real-time PCR technique for simultaneous amplification, detection, and quantification of DNA on the basis of conventional PCR principles (sequences of denaturation, annealing, elongation) has been successfully introduced. In overcoming the difficulties of the previously described PCR technique, this method enables direct online measurement of PCR products generated during the amplification procedure after each cycle. Increasing DNA concentrations are therefore directly measured by excitation of selected fluorescence dyes, by use of highly specialized instruments (e.g. TaqMan, LightCycler, RotorGene). These instruments are directed at the major amplification principle (melting, annealing, amplification) each providing a different physical performance by using heating blocks or a stream of hot air, glass capillaries, or plastic tubes for the reaction mixture. Distinct challenges of the instruments have to be elucidated by the researcher in advance. The interested reader may refer to further publications providing detailed information about real-time PCR systems and evaluating available instruments and important probe chemistry (Schmittgen 2001; Giulietti et al. 2001); distinct real-time approaches are also described in detail in Chapters 10 and 11. There are three common approaches to online detection. Each is based on fluorescence detection, and uses: 1. a DNA double-strand-specific fluorescence dye (SYBR-green); 2. exonuclease probes (TaqMan Probes); and/or 3. hybridization probes (HybProbes or hairpin probes, like Scorpions or Beacons).

169

170

8.4 Nucleic Acid Amplifikation Methods using PCR

Because a specific fluorescence signal is generated and collected after each cycle, subsequent quantification can be made continuous during the logarithmic phase, without the uncertain and probable arrested end-points of the reaction that characterized former PCR amplification techniques. The simplest approach is to measure synchronously the increase in generated PCR product using SYBR-green (Wittwer et al. 1997). A disadvantage of this method is its lack of discrimination between amplicon-specific and unspecific double-stranded DNA in the reaction tube. The sequence of the resulting product is therefore verified by a reasonable melting-curve analysis that separates potential unspecific side products from the desired known amplicon. The benefits of this method are its easy application and relatively low cost. Another method of measuring the increase in the resulting PCR products is to use additional hybridizing oligonucleotides and the two PCR primers. The main advantage of internally hybridizing fluorescence-labeled probes is the synchronous detection of sequence specificity and amplification efficiency after each PCR. The first established real-time PCR detection system uses two dyes coupled to one probe (Holland et al 1991). This probe, which is internally hybridized to the generated PCR product, is labeled with both a reporter dye and a quencher dye; this results in suppression of light emission. By employing the exonuclease activity of the Taq-polymerase used, the reporter dye is liberated from the quencher during the elongation, thereby generating a fluorescence signal that is proportional in intensity to the number of templates present (Fig. 8.3). A third technique has been introduced which successfully applies the fluorescence resonance energy-transfer (FRET) principle (Wittwer et al. 1997). In detail, two closely adjacent dye molecules can modulate light emission if they are located within the range of one to five bases. In reality, two internal oligonucleotides

3´

5´

R Q

Fig. 8.3 Principle of the 5 nuclease assay (TaqMan). An internal probe labeled with a reporter (R) at the 5 end and a quencher (Q) at the 3 end is split by the exonuclease-activity of the Taq polymerase (green circle) during the elongation phase of each PCR cycle, leading to an increased fluorescence emission.

8 DNA-based Methods for Detection of Genetic Modifications

lying adjacent were labeled with a sensor and an anchor dye, respectively. After hom*ologous hybridization of both HybProbes, specific light emission is detected (Fig. 8.4A). Another alternative is the molecular beacon, a double-labeled oligonucleotide that fluoresces only during self-hybridization (Fig. 8.4B). Further developments are in the pipeline that provide specialized real-time PCR applications. Several practical applications for detection of GMOs in food have been based on this technique; these might lead to a harmonized international modus operandi (Pietsch and Waiblinger 2001; Dahinden et al. 2001). Newly developed real-time PCR procedures developed to analyze food-borne pathogens and GMOs have been reviewed elsewhere (Reischl et al. 2002). It is likely that absolute quantification of GMO gene fragments will be advisable when referring to obligatory threshold levels, and this will lead to specific requirements with regard to accuracy and standardization (Niesters 2001; see also Chapters 10 and 11). The extreme power of real-time PCR is well illustrated by introducing multiplex PCR approaches that enable synchronous detection of up to 27 genetic variations. In this respect, a new two-dimensional array composed of color and melting temperature (Tm) data was recently described (Wittwer et al. 2001). In summary, recently developed real-time techniques are based on the intensity of the fluorescent dye-modulated light being directly proportional to the amplified DNA product. The most recent real-time PCR approaches enable generation of

A.) Hybridization Probes: D

3´

5´

B.) Hairpin Probes: D

A D

Fig. 8.4 Application of real-time quantification principles based on fluorescence resonance energy transfer (FRET). (A) Hybridization probes: two hybridization probes generate a specific fluorescence signal only when hybridizing side by side on the target DNA. The first dye (donor = D) transfers its energy to the second dye (acceptor = A).

The resulting fluorescence is directly proportional to the number of target molecules. (B) Molecular beacons: a single end-labeled oligonucleotide (D, donor; A, acceptor) emits light only during self-hybridization via FRET. After specific target-recognition the dyes will depart and the specific fluorescence disappears.

171

172

8.4 Nucleic Acid Amplifikation Methods using PCR

both qualitative and quantitative (absolute and relative) GMO observation within several hours, including enhanced sensitivity, high throughput, and the ability to perform simultaneous multiplex reactions and to minimize unnecessary post-PCR manipulations. Only in conjunction with optimized sample selection and processing, contamination-free DNA extraction, and suitable real-time PCR methods can valid data interpretation be provided on the basis of such extremely sensitive PCR assays (Klaften et al. 2004). Several reports are available investigating cross platform studies and suitable calibrator or reference materials and providing different recommendations for detecting GMOs by real-time PCR (Terry, Shanahan et al. 2002; Taverniers et al. 2004, 2005) The absolute quantification of gene fragments by use of PCR will, however, remain a challenge that depends mainly on the technique employed, on the instrumental hardware and software used, and, finally, on the availability of highly calibrated standards for each genetic modification. 8.4.3 Important Bioinformatic Considerations

Without sufficient bioinformatic support, a reliable conclusion and final decision about the presence of GMOs in food would not be possible. The availability of valuable computer software, gene databases, statistical requirements, and normalization procedures should be considered when generating and handling PCR results. Experience has proved that not all selected amplicons will produce good assay results, thereby stressing the importance of the initial search for the most suitable amplicon and probe combinations. Several software packages are available which support primer and/or probe selection and hom*ology searches in gene databases (HUSAR, EMBL-EBI). Success in both theoretical and practical specificity predictions enables highly reliable PCR-mediated GMO monitoring to be performed. Requirements when performing relative or absolute quantification using real-time-PCR must be elucidated, taking into consideration the advantages and disadvantages reviewed by Wong and Medrano (2005); these are not only satisfied by applying sophisticated mathematical models and normalization strategies. Additional quantification problems may arise because of shifting genome equivalents in different GMO tissues (e.g. paternal versus maternal events, described by Yoshimura et al. 2005, or multiple chloroplast versus single nuclear gene copy numbers), but contaminating environmental DNA must also be taken carefully into account. The absolute number of GMO-specific DNA molecules should exceed twenty copies in the isolate to enable good statistical probability (Kay and Van den Eede 2001). An important objective is to achieve reliable analysis and interpretation of generated quantitative PCR data (Burns et al 2004). As a consequence, standardization of GMO analysis using PCR has been extensively discussed, and several international trials have been reported (Roseboro 2000, Pöpping 2001, Anklam et al. 2002) with acceptable limits of detection that serve the regulatory requirements of each authority (Huebner et al. 2001, Einspanier 2001a).

8 DNA-based Methods for Detection of Genetic Modifications

8.5 Alternative and Promising DNA Detection Techniques

In addition to the above-described PCR-based techniques, several alternative methods of DNA detection have been developed which are based on DNA augmentation. New technological developments might lead towards a new set of nucleic acid labeling and/or detection methods exploiting electrochemical sensors, nanoparticles, microfluidic devices, or combinations of these innovative approaches (Wang et al. 2003; Carpini et al. 2004; Kalogianni et al. 2005; Obeid et al. 2004; Kim et al. 2005; Jain 2005) Among these, a number of nonPCR methods have been described for amplification of nucleic acids. These rely mainly on primer-based amplification; variations involving the replication and detection of gene fragments are described below. Although some of these DNA-detection techniques are currently limited with regard to GMO analysis, future developments will undoubtedly extend the viability of these techniques. Clever combination with the PCR technique of the different methods described below should, however, be recognized being of high potential, as shown, e.g., for micro-arrays and nanotechnology. 8.5.1 Thermal Cycling Procedures

Ligase chain reactions (LCR) (Barany 1991) have been introduced to employ either linear or exponential amplification by covalently bridging two adjacent primers through a heat-stable DNA ligase. Subsequent haptene-mediated detection of the ligated oligonucleotides enables the analysis of fewer than 100 target molecules (Kratochvil and Laffler 1994). Reliable monitoring approaches have been established using a combination of PCR, LCR, and enzyme-immunoassay detection (PCR-LCR-EIA) when testing for dairy product adulteration (Klotz et al. 2001). A combined PCR-LCR method on a micro-array platform has recently been successfully introduced for detection of five transgene events in food samples (Bordoni et al. 2005) This technique is most advantageous for discrimination between different genotypes using a single base exchange, and may be most valuable in screening transgene DNA. The possible robotic application of such combined assay systems should provide additional verification systems that utilize not only single point mutations but also genetically modified regions within GMOs. 8.5.2 Isothermic Amplification

The nucleic acid sequence-based amplification (NASBA) technique mimics the retroviral strategy of RNA replication to accumulate cDNA and RNA (Guatelli et al. 1990). After introducing an artificial T7 promoter sequence through the first primer, NASBA operates continuously by taking advantage of the isothermal mode of action of a T7-DNA-dependent RNA-polymerase amplifying the gene of interest determined by the primers. This procedure will finally achieve rapid, exponential

173

174

8.5 Alternative and Promising DNA Detection Techniques

nucleic acid amplification (1010-fold) within 1–2 h (Malek et al. 1994). Comparable new techniques have been introduced – for example rolling cycle amplification (RCA; Lizardi et al. 1998), ramification amplification (RAM; Zhang et al. 1998), and strand-displacement amplification (SDA); all of these have their own advantages in the process of multiplying DNA or RNA using isothermal nucleic acid polymerization. 8.5.3 DNA Microarrays

The need for rapid high-throughput diagnostic systems has led to the development of miniaturized hybridization and detection techniques that have created a new industrial standard, the microarray. Highly specific oligonucleotides, fixed in situ on carriers suitable for microscopic investigations, have been introduced (Southern et al. 1992). Further developments now enable a broad range of unique nucleic acid profiling. To screen for and to specify any genetically modified ingredient, newly developed microarray platforms enable profiling of different GMOs in one step have been introduced (Aarts et al. 2002). Specific hybridization of labeled sample DNA on to fixed-capture nucleotides provides redundant information about the quality and initial quantity estimates of potential transgenes, most of which were analyzed using fluorescence tags (Fig. 8.5A). By introducing peptide nucleic acid (PNA)-based arrays, multiplex PCR mixtures have been successfully identified on five transgenic DNAs (Germini et al. 2005). Currently, imaging of DNA microarrays has mainly been based on use of organic dyes (fluorescence label). These methods may suffer from problems including photobleaching, low labeling efficiency, and, subsequently, reduced sensitivity, although several recently developed electrical, enzymatic, scanning force microscopy, capillary electrophoresis, nanoparticle, and optical detection methods have been considered and successfully applied to overcome such problems (Hintsche et al. 1997 Zhou and Zhou 2004; for reviews: Möller et al. 2000; Müller et al. 2000). Remarkably, compared with the total number of recently published studies introducing GMO detection methods, specifically adapted microarray systems will play a major role. 8.5.4 Microfluidic and Nanoparticle Techniques

Micro and nanotechnology, a novel field of DNA research, might remarkably accelerate the development of novel GMO detection methods. The great potential of nanotechnology has been discovered for clinical applications (Jain 2005; a review has been published by Kubik et al. 2005). It can, therefore, be assumed that two important developments might accelerate the efficiency of GMO detection in routine applications: • nanoparticles, and • microfluidic devices.

8 DNA-based Methods for Detection of Genetic Modifications A.) Micro-Array : 2 1

B.) SPR:

1 3

RI C.) Marker Rescue: GMO target gene recombination

P P

hom*ologue bacterial gene

recovered viability

amplification and detection utilizing bacterial growth

Fig. 8.5 Alternative detection methods applicable to monitoring of genetic modifications. (A) Micro array system enabling selective hybridization of dye-labeled nucleic acids (2) on to gene-specific oligonucleotides (1) fixed in micro spots on a glass slide (3). A very large amount of distinct genetic information will be obtained from a single experiment, because of the possibility of placing numerous probes on one carrier. (B) Surface plasmon resonance (SPR). Surface-immobilized probes (1) interact

with free unlabeled sample DNA (2), resulting in a detectable change of the refractive index (RI) of light reflected from a sensor chip surface (thin metal film, 3). (C) Marker rescue using hom*ologue recombination techniques. Genetic recombination between the target gene and a bacterial hom*ologue with an inactive promoter leads to renovation of vital function. Specific growth of transformed bacteria indicates the presence of GMO DNA. P = bacterial promoter.

New dimensions in DNA detection are being opened up not only the superior stability of nanoparticles compared with fluorescence dyes but also by the different modes of detection (Drummond et al. 2003). Advantageous fluorescence-free detection of specific DNA hybridization can be achieved by infrared absorption spectroscopy and by colorimetric or electrochemical methods using gold, silica, or carbon nanoparticles (Moses et al. 2004; Zhou and Zhou 2004; Storhoff et al. 2004; Wang et al. 2003). A first practical application, detection of genetically modified organisms using nanoparticles, was developed by Kalogiannu et al. (2005).

175

176

8.5 Alternative and Promising DNA Detection Techniques

Microfluidic systems have been developed which enable reproducible detection and quantification of DNA (a review has been published by Auroux et al. 2004). For example, several types of microfluidic “lab-on-a-chip” technology are currently available not only for simultaneous verification and quantification of PCR products (Birch et al. 2001) but also for multiple PCR amplification on micro devices (Munchow et al. 2005). In more detail, micro devices working practically with capillary electrophoresis chips have recently been introduced for GMO detection (Kim et al. 2005) and enable analysis of 0.1% GMO content starting with only 20 template molecules (Obeid et al. 2005). Specially developed functional piezoelectric affinity sensors can detect GMO-DNA-hybridization directly by means of oligonucleotides immobilized on electrode surfaces generating piezoelectric signals (Minunni et al. 2001), and thus specifically indicating the presence of transgenes. For sufficient assay sensitivity, however, prior DNA target amplification is usually necessary. Such nanotechniques may provide the future platform for the detection and quantification of GMO DNA in a rapid and cost-effective manner on disposable material, thus limiting crucial cross contamination. 8.5.5 Mass Spectrometry (MS) of DNA

PCR products can be rapidly analyzed by use of mass spectrometry-based methods, for example electrospray MS or MALDI–TOF (matrix-assisted laser desorption ionization–time-of-flight), both of which were originally developed to enable investigation of other organic polymers, for example proteins. Currently, DNA fragments are characterized on the basis of their mass and charge, which enables determination of the sequence of short gene fragments of ~200 bp (Chapman 1998). Application of this rapid and sensitive technique to short DNA sequences and to genetic changes in plant and viral genomes (Amexis et al. 2001) should lead to a dramatic reduction in analysis time (Larsen et al. 2001). DNA MS techniques have successfully been introduced in clinical studies and now enable accelerated mutation research (a review has been published by Gut 2004). Comparison of transgene and conventional genomes by using species-specific genome-fragment libraries for reference should enable rapid discrimination between GMO and nonGMO samples. Short DNA repeats were recently successfully analyzed by use of MS techniques for forensic purposes (Carey and Mitnik 2002). Although MS analysis of DNA is currently limited by the molecular size of nucleic acids, these detection methods will become increasingly important as high-throughput applications become common. 8.5.6 Supplementary Photon-driven Monitoring Methods

Fluorescence correlation spectroscopy (FCS), which was developed in the mid1970s, is the method of choice for analysis of biomolecular nanostructures. The principle of the method is analysis of fluctuations of fluorescence intensity, and

8 DNA-based Methods for Detection of Genetic Modifications

the technique has been described as a reliable and rapid tool for detection of PCR products (Björling et al. 1998). In principle, FCS is based on resolution of the thermal fluctuation of single molecules (one partner must be dye-labeled) by fluorescence measurement that is auto-correlated with the particle concentration. FCSbased quantitative PCR has the advantages of being sensitive and both time and labor-saving, and hence is becoming increasingly important for single-molecule detection-based diagnosis (SMDD). Ultimately, the FCS method will most probably be used in a wide variety of biological applications (a review has been published by Thompson 1991). More recently, FCS-based PCR has been used in screening experiments, in which it utilizes the intermolecular aggregations of pathogenic nucleic acids (Walter et al. 1996). On the basis of recent SMDD data, this method of detection should enable analysis of genetic material, but without prior extensive PCR amplification (Kinjo and Rigler 1995; Kask et al. 1999). Surface plasmon resonance (SPR) is another prominent, yet label-free, photon technology suitable for monitoring intermolecular relationships in very small sample volumes. This optical technique enables detection and quantification of changes in refractive index (RI) in the vicinity of a sensor chip’s surface to which ligands have been immobilized; this enables any interaction of biomolecules with the ligand to be detected (a review has been published by McDonnell 2001). In detail, one side of a glass prism is coated with a very thin layer of metal to which a DNA probe (single strand) is attached. When a light beam passes through the prism the energy of the beam interacts with the cloud of electrons in the metal film, causing oscillation of electrons (= plasmon) (Alberts et al. 2002). Reflection of the beam occurs at a certain resonance angle. When DNA binds to the metal film of the probe the composition of the molecular complex on the metal surface changes, thus causing a shift in reflection angle that is characterized as RI (Fig. 8.5B). By using SPR, the numbers of molecules bound in each complex can be determined. In addition to its use in detecting different DNA molecules after PCR amplification (Kai et al. 1999), the method has been successfully used to detect GMOs in food samples after PCR amplification (Feriotto et al. 2002, 2003). A major advantage of the method is that it can be combined directly with miniaturized biosensor technology, thereby enabling DNA measurements to be made without previous probe labeling and in reusable continuous flow systems. 8.5.7 Novel Biological Monitoring Approaches

In addition to the physicochemical methods described above, other strategies have been introduced for detection of DNA on the basis of biological effects of foreign genes within organisms. A technique which takes advantage of naturally occurring hom*ologue recombination between two distant, but hom*ologous, DNA fragments has been developed for detection of transgenic targets by use of artificial microbial gene loci. In accordance with the so-called “marker rescue” method, the finally surviving transformed microorganisms were grown and amplified in culture media, indicating

177

178

8.6 Conclusions and Future Prospects for GMO Detection by DNA Alalysis

a positive event (Fig. 8.5C) (Contente and Dubnau 1979). In principle, deficient mutant strains containing a hom*ologue gene of interest, and a selective medium in which only the reconverted wild-type can survive, are provided. Subsequently, the GMO target can be detected by hom*ologue recombination with the mutant possessing a functional promoter; this leads, after successful recombination, to bacterial growth in the selective medium. This technique was recently used to detect antibiotic resistance marker genes derived from environmental GMO plant material (de Vries and Wackernagel 1998). Remarkable long-term persistence of functional gene fragments derived from GMOs has been monitored in soil by use of this technique (de Vries et al. 2003). In the future, the technique – by using transformation events to detect GMO DNA from different sources – may lead to an interesting biological monitoring approach in which prior PCR amplification steps can be omitted. In contrast, so-called unintended effects might be used to detect genetic modification directly within the GMOs. This new concept will go beyond the originally calculated genetic modification searching for not premeditated changes in the expression pattern (Cellini et al. 2004). This means that integrated foreign genes may interact, via positioning effects, with the physiology of each transgene organism. Remarkable metabolic changes might therefore occur, and could be recorded by differential measurement of random expression properties or distinct candidate transcripts. This would apply several differential profiling methods, for example the DDRT (differential display reverse transcription)-PCR technique, used to detect changing cDNA patterns within the GMO plant without a known nucleic acid target. High-throughput DNA techniques, like microarrays, are suitable only if the complete genome of the investigated organism is known. Metabolic and proteomic changes will also be monitored, supporting the evidence of such integral GMO analysis. New methods are currently under development to monitor such interactions, in contrast with the conventional physiological reaction after the transgene event occurs (Le Gall et al. 2003). This will call for sensitive, comprehensive, highthroughput systems capable of detecting multiple cellular properties, and should lead to a holistic insight that might enlighten the multiple biological interactions mediated by any desired genetic modification. Analysis of cellular ribonucleic acids (RNA) might therefore be an important means of detecting expression differences indicative of positioning effects within the genomes of the transgene and isogene organisms.

8.6 Conclusions and Future Prospects for GMO Detection by DNA Analysis

During the past decade, a range of universal and reliable methods based on detection of residual DNA have been developed for screening and quantification of GMOs in food or feedstuffs. Extensive requirements to seek low yet abundant amounts of GMO DNA in diverse sample materials, as stipulated by the most recent legislative regulations, are currently satisfied exclusively by use of PCR meth-

8 DNA-based Methods for Detection of Genetic Modifications

ods. Alternative profiling techniques for comparing individual GMOs with their non-GMO counterpart might, however, be the future focus, especially for safety evaluation of GMO-derived food and feed (Kuiper et al. 2003). It is clear that DNA is the ideal molecule for establishing international GMO screening and quantification systems leading to reliable certification, although the development of such ubiquitous methods is currently hindered by the uncertainty and increasing number of genetic modifications in released GMOs. Preparing for future development of commercial GMO products from fed animals should also be taken into account when attempting to prove the existence of residual recombinant DNA derived from transgenic feed (Einspanier et al. 2001b; Klotz et al. 2002). Ongoing research in progress should enable the development of techniques for detection of traces of GMO material on the basis of DNA methods. To summarize, DNA-based techniques have the key advantages of high sensitivity and robust and rapid operation while satisfying the prerequisites of careful experimental design that avoids false negative and/or false-positive results. Today, real-time PCR seems to be the best-developed and most suitable GMO monitoring system, and highly sensitive, specific, reliable, quantitative, and rapid detection is available (Chapters 10, 11 and 12). Although related methods will clarify food production processes in relation to GMO components, natural DNA is present in virtually all daily food components, and any toxicological fears about such food-born DNA can be excluded. On this basis, a number of safety considerations of transgenic DNA have been discussed (Jonas et al. 2001) and are of continuing scientific interest. In addition, developed assay methods will not only be used to detect residual GMO DNA, but also to examine its biological potency with regard to possible environmental interactions. In this content, possible horizontal gene transfer from GMOs to, e.g., gut bacteria is still a topic of ongoing scientific discussion. European research projects which have dealt extensively with this topic are now providing sufficient risk assessment results for public discussion (van den Eede et al. 2004). Investigating the fate of GMO gene fragments, and their biological effects, by use of the newest DNA technology, will therefore enable sustainable risk assessment of transgene food and feed. Prospectively, the rapidity and sensitivity of DNA-based detection methods used to identify the GMO content of food will, as a result of flexibility and frugality, become the favored method of screening and quantification. In particular, care must be taken when calculating absolute amounts of GMO-specific DNA fragments with regard to sample variability, for example alteration of natural copy numbers of the target genes in the nucleus compared with in mitochondria or chloroplasts. Routine quantification of GMO in food or feedstuffs is currently performed reliably only in specialized laboratories using highly standardized and controlled procedures. These DNA-based assay systems are still cost-intensive and require sophisticated instrumentation and laboratory equipment for their operation. Further developments may lead to simple and less expensive methods for DNA screening adjusted to market requirements, especially with the background of commercial availability of rapidly growing numbers of different GMOs. This might require the use of

179

180

References

rapid test-strip kits for initial screening procedures, which will ease the burden on somewhat limited government food-monitoring budgets. Finally, the most convincing advantage of DNA-based methods for detecting GMOs remains the robust nature of DNA in numerous sample-degradation procedures, together with the possibility of massive signal amplification within a short time if residual DNA is shown to be present. In the future, analysis of GMOs by use of DNA technology will continue to evolve, and combination with other innovative techniques, for example micro and nano-systems, will enable holistic and rapid analysis satisfying the great demand for food inspection.

References Aarts H.J., van Rie J.P., Kok E.J. (2002) Traceability of genetically modified organisms. Expert Rev Mol Diagn 2(1), 69–76. Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P (2002) Molecular biology of the cell, Garland Science, Taylor and Francis Group, NY. Amexis G, Oeth P, Abel K, Ivshina A, Pelloquin F, Cantor CR, Brau A, Chumakov K (2001) Quantitative mutant analysis of viral quasispecies by chip-based MALDI–TOF mass spectrometry. Proc. Natl. Acad. Sci. USA 98, 12097–12102. Anklam E, Gadani F, Heinze P (2002) Analytical methods for detection and determination of genetically modified organisms in agricultural crops and plant-derived food products. Eur. Food Res. Technol 214; 3–26. Auroux PA, Koc Y, deMello A, Manz A, Day PJ. (2004) Miniaturised nucleic acid analysis. Lab Chip. 4, 534–546. Barany F (1991) Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc Natl Acad Sci USA 88, 189–193. Bertheau Y, Diolez A, Kobilinsky A, Magin K.(2002) Detection methods and performance criteria for genetically modified organisms. J AOAC Int. 85, 801–808. Birch L, Archard CL, Parkes HC, McDowell DG (2001) Evaluation of LabCGip technology for GMO analysis in food. Food Control 12, 535–540. Björling S, Kinjo M, Földes-Papp Z, Hagman E, Thyberg P, Rigler R (1998) Fluorescence correlation spectroscopy of enzymatic

DNA polymerization. Biochemistry, 37, 12971–12978. Bonfini L, Heinze P, Kay S, van den Eede G (2002) Review of GMO Detection and Quantification Techniques. EUR 20384/EN. Bordoni R, Germini A, Mezzelani A, Marchelli R, De Bellis G. (2005) A microarray platform for parallel detection of five transgenic events in foods: a combined polymerase chain reaction-ligation detection reaction-universal array method. J Agric Food Chem. 53, 912–918. Brunnert HJ, Spener F, Boerchers T (2001) PCR-ELISA for the CaMV-35S promoter as a screening method for genetically modified Roundup Ready soybeans. Eur. Food Res Technol 213, 366–371. Burns MJ, Valdivia H, Harris N. (2004) Analysis and interpretation of data from real-time PCR trace detection methods using quantitation of GM soya as a model system. Anal Bioanal Chem. 378, 1616–1623. Carey L, Mitnik L (2002). Trends in DNA forensic analysis. Electrophoresis 23, 1386–1397. Carpini G, Lucarelli F, Marrazza G, Mascini M. (2004) Oligonucleotide-modified screenprinted gold electrodes for enzyme-amplified sensing of nucleic acids. Biosens Bioelectron. 20, 167–175. Cellini F, Chesson A, Colquhoun I, Constable A, Davies HV, Engel KH, Gatehouse AM, Karenlampi S, Kok EJ, Leguay JJ, Lehesranta S, Noteborn HP, Pedersen J, Smith M (2004) Unintended effects and their detection in genetically modified crops. Food Chem Toxicol. 42, 1089–1125.

8 DNA-based Methods for Detection of Genetic Modifications Chapman JR (1998) Mass spectrometry, in: Molecular Biomethods Handbook (Rapley R Walker JM, eds.), Humana Press, Totowa, NJ. Contente S, Dubnau D (1979) Marker rescue transformation by linear plasmid DNA in Bacillus subtilis. Plasmid 2, 555–571. Dahinden I, Zimmermann A, Liniger M, Pauli U (2002) Variation analysis of seven LightCycler-based real-time PCR systems to detect genetically modified products (RRS, Bt176, Bt11, Mon810, T25, Lectin, Inverstase). in: Rapid Cycle Real-time PCR, methods and Applications – Microbiology and Food analysis (Reischl U, Wittwer C, co*ckerill, eds.), Springer Berlin. van Duijn GJ, van Biert R, Bleeker-Marcelis H, Van Boeijen I, Ada AJ, Jhakrie S, Hessing M (2002) Detection of genetically modified organisms in foods by proteinand DNA-based techniques: bridging the methods. J AOAC Int 85, 787–791. Drummond TG, Hill MG, Barton JK. (2003) Electrochemical DNA sensors. Nat Biotechnol. 21,1192–1199 van den Eede G, Aarts H, Buhk HJ, Corthier G, Flint HJ, Hammes W, Jacobsen B, Midtvedt T, van der Vossen J, von Wright A, Wackernagel W, Wilcks A (2004) The relevance of gene transfer to the safety of food and feed derived from genetically modified (GM) plants. Food Chem Toxicol 42, 1127–1156. Einspanier (2001a) Quantifying genetically modified material in food: searching for a reliable certification. Eur. Food Res. Technol 213, 415–416 Einspanier R, Klotz A, Kraft J, Aulrich K, Poser R, Schwaegele F, Jahreis G, Flachowsky G (2001b) The fate of forage plant DNA in farm animals: A collaborative casestudy investigating cattle and chicken fed recombinant plant material. Eur.Food Res. Technol. 211, 129–134. Feriotto G, Borgatti M, Mischiati C, Bianchi N, Gambari R (2002) Biosensor technology and surface plasmon resonance for real-time detection of genetically modified roundup ready soybean gene sequences. J Agric Food Chem 27, 955–962. Feriotto G, Gardenghi S, Bianchi N, Gambari R. (2003) Quantitation of Bt-176 maize genomic sequences by surface plasmon resonance-based biospecific interaction

analysis of multiplex polymerase chain reaction (PCR). J Agric Food Chem. 51, 4640–4646. Le Gall G, Colquhoun IJ, Davis AL, Collins GJ, Verhoeyen ME. (2003) Metabolite profiling of tomato (Lycopersicon esculentum) using 1H NMR spectroscopy as a tool to detect potential unintended effects following a genetic modification. J Agric Food Chem. 51, 2447–2456. Garcia-Canas V, Gonzalez R, Cifuentes A.(2004) Sensitive and simultaneous analysis of five transgenic maizes using multiplex polymerase chain reaction, capillary gel electrophoresis, and laserinduced fluorescence. Electrophoresis 25, 2219–2226. Germini A, Rossi S, Zanetti A, Corradini R, Fogher C, Marchelli R. (2005) Development of a peptide nucleic acid array platform for the detection of genetically modified organisms in food. J Agric Food Chem. 53, 3958–3962. Gilbert (1999) Sampling of raw materials and processed foods for the presence of GMOs. Food Control 10, 363–365. Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C (2001) An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods 25, 386–401. Gryson N, Ronsse F, Messens K, Loose de M, Verleven T, Dewettinck K (2002) Detection of DNA during the refining of soybean oil. J Am Oil Chem Soc 79, 171–174. Guatelli JC, Whitfield KM, Kwoh DY, Barringer KJ, Richman DD, Gingeras TR (1990) Isothermal, in vitro amplficication of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc. Natl. Acad. Sci. USA 87, 1874–1878. Gut IG. (2004) DNA analysis by MALDITOF mass spectrometry. Hum Mutat. 23, 437–444. Hemmer W, Pauli U (1998) Labelling of food products derived from genetically engineered crops. A survey on detection methods. Eur Food Law Rev 9, 27–38. Hernandez M, Rodriguez-Lazaro D, Zhang D, Esteve T, Pla M, Prat S. (2005) Interlaboratory transfer of a PCR multiplex method for simultaneous detection of four genetically modified maize lines: Bt11, MON810,

181

182

References T25, and GA21. J Agric Food Chem. 53, 3333–3337. Hintsche R, Paeschke M, Uhlig A, Seitz R (1997) Microbiosensors using electrodes made in Si-technology. EXS 80, 267–283. Holland PM, Abramson RD, Watson R, Gelfand DH (1991) Detection of specific polymerase chain reaction product by utilizing the 5–3 exonuclease activity of Thermus aquaticis DNA polymerase. Proc. Natl. Acad. Sci. USA 88, 7276–7280. Holst-Jensen A, Ronning SB, Lovseth A, Berdal KG. (2003) PCR technology for screening and quantification of genetically modified organisms (GMOs). Anal Bioanal Chem. 375, 985–993. Holst-Jensen A, Berdal KG (2004) The modular analytical procedure and validation approach and the units of measurement for genetically modified materials in foods and feeds. J AOAC Int. 87, 927–936. Hoss M. (1995) Ancient DNA. Horm. Res. 43, 118–120. Huebner P, Waiblinger HU, Pietsch K, Brodmann P (2001) Validation of PCR methods for quantitation of genetically modified plants in food. J AOAC Int 84,1855–1864. Hupfer C, Hotzel H, Sachse K, Moreano F, Engel KH (2000) PCR-based quantifiation of genetically modified Bt maize: singlecompetitive versus dual competitive approach. Eur Food Res Technol 212, 95–99. Innis MA, Gelfand DH, Sninsky JJ (1990) PCR protocols – a guide to methods and applications. Academic Press, San Diego. Jain KK (2005) Nanotechnology in clinical laboratory diagnostics. Clin. Chim. Acta. 358, 37–54. Jonas DA, Elmadfa I, Engel KH, Heller KJ, Kozianowski G, König A, Müller D, Narbonne JF, Wackernagel W, Kleiner J (2001) Safety considerations of DNA in food. Ann Nutr Metab 45, 235–254. Kai E, Sawata S, Ikebukuro K, Iida T, Honda T, Karube I (1999) Detection of PCR products in solution using surface plasmon resonance. Anal Chem 15, 796–800. Kalogianni DP, Koraki T, Christopoulos TK, Ioannou PC. (2005) Nanoparticle-based DNA biosensor for visual detection of genetically modified organisms. Biosens Bioelectron.(online available 1 June 2005).

Kask P, Palo K, Ullmann D, Gall K (1999) Fluorescence-intensity distribution analysis and its application in biomolecular detection technology. Proc. Natl. Acad. Sci. USA 96, 13756–13761. Kay S, Van den Eede G (2001) The limits of GMO detection. Nature Biotechnol. 19, 405. KimYJ, Chaes JS, Chang JK, Kang SH (2005) Microchip capillary gel electrophoresis using programmed field strength gradients for the ultra-fast analysis of genetically modified organisms in soybeans. J. Chromatogr. A. 1083, 179–184. Kinjo M, Rigler R (1995) Ultrasensitive hybridization analysis using fluorescence correlation spectroscopy. Nucl Acid Res 23, 1795–1799. Klaften M, Whetsell A, Webster J, Grewal R, Fedyk E, Einspanier R, Jennings J, Lirette R, Glenn K (2004) Development of Polymerase Chain Reaction Methods to Detect Plant DNA in Animal Tissues. in: Agricultural Biotechnology: Challenges and Prospects, pp. 83–99; Eds: Bhalgat M.M., Ridley W. P., Felsot A. S., Seiber J. N., ACS Symposium Series 866; American Chemical Society Washington DC. Klotz A, Einspanier R (2001) Development of a DNA-based screening method to detect cows milk in ewe, goat and buffalo milk and dairy products by PCR-LCR-EIA-technique. Milk Science International – Milchwissenschaft Vol. 56 (2), 67–70. Klotz A, Mayer J, Einspanier R (2002) Carry over of feed-DNA into farm animals: first investigations with pigs, chicken embryos and commercial available chicken samples. Eur. Food Res.Technol.214, 271–275. Kratochvil J, Laffler TG (1994) Nonradioactive oligonucleotide probes for detecting products of the ligase chain reaction. in: Methods in Molecular Biology 28 (Isaac PG, ed.), Humana, Totowa, NJ, USA. Kubik T, Bogunia-Kubik K, Sugisaka M (2005) Nanotechnology on duty in medical applications. Curr Pharm. Biotechnol. 6, 17–33. Kuiper (1999) Summary report of the ILSI Europe workshop on detection methods for novel food derived from genetically modified organisms. Food Control 10, 339–349.

8 DNA-based Methods for Detection of Genetic Modifications Kuiper HA, Kok EJ, Engel KH. (2003) Exploitation of molecular profiling techniques for GM food safety assessment. Curr Opin Biotechnol. 14, 238–243. Larsen LA, Christiansen M, Vuust J, Andersen PS (2001) Recent developments in high-throughput mutation screening. Pharmacogenomics 2, 387–399. Lee DK, Seok SJ, Jang IC, Nahm BH, Kim JK (1998) Triprimer-PCR method: rapid and reliable detection of transgenes in transgenic rice plants. Mol Cell 8, 101–106. Lipp M., Anklam E., Stave JW (2000) Validation of an immunoassay for detection and quantitation of a genetically modified soybean in food and food fractions using reference materials: interlaboratory study. J. AOAC Int. 89, 919–927. Lizardi PM, Huang X, Zhu Z, Bray-Ward P, Thomas DC, Ward DC (1998) Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nature Genet. 19, 225–232. Malek L, Sooknanan R, Compton J (1994) Nucleic acid sequence-based amplification (NASBA). in: Methods in Molecular Biology 28 (Isaac PG, ed.), Humana Press, Totowa, NJ. Matsuoka T, Kuribara H, Akiyama H, Miura H, Goda Y, Kusakabe Y, Isshiki K, Toyoda M, Hino A (2001) A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize. Shokuhin Eiseigaku Zasshi 42 (1), 24–32. Matsuoka T, Kuribara H, Takubo K, Akiyama H, Miura H, Goda Y, Kusakabe Y, Isshiki K, Toyoda M, Hino A (2002) Detection of recombinant DNA segments introduced to genetically modified maize (Zea mays). J Agric Food Chem 50, 2100–9. McCabe MS, Power JB, de Last AM, Davey MR (1997) Detection of single-copy genes in DNA from transgenic plants by nonradioactive Southern blot analysis. Mol Biotechnol. 7, 79–84. McDonnell JM (2001) Surface plasmon resonance: towards an understanding of the mechanisms of biological molecular recognition. Curr Opin Chem Biol 5, 572–577. Minunni M, Tobelli S, Pratesi S, Mascini M, Piatti P, Bogani P, Buiatti M, Mascini M (2001) A piezoelectric affinity biosensor for genetically modified organisms (GMOs) detection. Anal Lett 34, 825–840.

Miraglia M, Berdal KG, Brera C, Corbisier P, Holst-Jensen A, Kok EJ, Marvin HJ, Schimmel H, Rentsch J, van Rie JP, Zagon J (2004) Detection and traceability of genetically modified organisms in the food production chain. Food Chem Toxicol. 42, 1157–1180. Möller R, Csaki A, Köhler M, Fritzsche W (2000) DNA probes on chip surfaces studied by scanning force microscopy using specific binding of colloidal gold. Nucleic Acids Res. 28, e91. Moses S, Brewer SH, Lowe LB, Lappi SE, Gilvey LB, Sauthier M, Tenent RC,Feldheim DL, Franzen S. (2004) Characterization of single- and doublestranded DNA on gold surfaces. Langmuir. 20, 11134–11140. Müller O, Hahnenberger K, Dittmann H, Yee H, Nagle R, Iisley D (2000) A microfluidic system for high speed reproducible DNA sizing and quantification. Electrophoresis 21, 128–134. Munchow G, Dadic D, Doffing F, Hardt S, Drese KS. (2005) Automated chip-based device for simple and fast nucleic acid amplification. Expert Rev Mol Diagn. 5, 613–620. Nielsen KM, Townsend JP (2004) Monitoring and modeling horizontal gene transfer. Nature Biotechnol. 22, 1110–1114. Niesters HG (2001) Quantification of viral load using real-time amplification techniques. Methods 25, 419–429. Obeid PJ, Christopoulos TK, Ioannou PC. (2004) Rapid analysis of genetically modified organisms by in-house developed capillary electrophoresis chip and laser-induced fluorescence system. Electrophoresis. 25, 922–930. Pääbo S (1993) Ancient DNA Sci. Am. 269, 86–92. Pauli U, Liniger M, Zimmermann A (1988) Detection of DNA in soybean oil.Food Res. Technol. 207, 264–267. Pietsch P, Waiblinger HU (2001) Quantification of genetically modified soybeans in food with the LightCycler system. in: Rapid cycle real-time PCR (Meuer S, Wittwer C, Nakagawara K, eds), Springer, Berlin. Pöpping B (2001) Methods for the detection of genetically modified organisms: Precision, pitfalls, and proficiency. Int Lab 31, 23–29. Quirasco M, Schoel B, Plasencia J, fa*gan J, Galvez A. (2004) Suitability of real-time

183

184

References quantitative polymerase chain reaction and enzyme-linked immunosorbent assay for cry9C detection in Mexican corn tortillas: fate of DNA and protein after alkaline cooking. J AOAC Int. 87 639–646. Rapley R (1998) Polymerase chain reaction. in: Molecular Biomethods Handbook. (Rapley R, Walker JM), Humana Press, Totowa, NJ, USA. Reischl U, Wittwer C, co*ckerill F (2002) Rapid Cycle Real-time PCR methods and Application – Microbiology and food analysis. Springer, Berlin. Rolfs A, Schuller I, Finckh U, Weber-Rolfs I (1992) PCR: Clinical diagnostics and research. Springer, Berlin. Roseboro K (2000) Standardizing GMO testing. Food Proc USA 61, 61–63. Sabelli PA (1998) Southern Blot Analysis. in: Molecular Biomethods Handbook. (Rapley R, WalkerJM), Humana Press, Totowa, NJ, USA. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N. (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230,1350–1354. Schmittgen TD (2001) Real-Time Quantitative PCR. Methods 25, 383–385. Southern EM (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503–517. Southern E, Maskos U, Elder R. (1992) Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucleotides: evaluation using experimental models. Genomics, 13, 1008–1017. Storhoff JJ, Lucas AD, Garimella V, Bao YP, Muller UR. (2004) hom*ogeneous detection of unamplified genomic DNA sequences based on colorimetric scatter of gold nanoparticle probes. Nat Biotechnol. 22, 883–887. Taverniers I, Van Bockstaele E, De Loose M. (2004) Cloned plasmid DNA fragments as calibrators for controlling GMOs: different real-time duplex quantitative PCR methods. Anal Bioanal Chem. 378, 1198–1207. Taverniers I, Windels P, Vaitilingom M, Milcamps A, Van Bockstaele E, Van den Eede G, De Loose M. (2005) Event-specific plasmid standards and real-time PCR meth-

ods for transgenic Bt11, Bt176, and GA21 maize and transgenic GT73 canola. J Agric Food Chem. 53, 3041–3052. Terry CF, Harris N, Parkes HC. (2002) Detection of genetically modified crops and their derivatives: critical steps in sample preparation and extraction. J AOAC Int. 85, 768–774. Terry CF, Shanahan DJ, Ballam LD, Harris N, McDowell DG, Parkes HC. (2002) Realtime detection of genetically modified soya using Lightcycler and ABI 7700 platforms with TaqMan, Scorpion, and SYBR Green I chemistries. J AOAC Int. 85, 938–944. Thompson NL (1991) Fluorescence Correlation Spectroscopy. In: Topic in Fluorescence Spectroscopy (Lakowicz JR, ed.), Plenum, NY, 337–378. de Vries J, Wackernagel W (1998) Detection of nptII (kanamycin resistance) genes in genomes of transgeneic plants by markerrescue transformation. Mol Gen Genet 257, 606–613. de Vries J, Heine M, Harms K, Wackernagel W. (2003) Spread of recombinant DNA by roots and pollen of transgenic potato plants, identified by highly specific biomonitoring using natural transformation of an Acinetobacter sp.. Appl Environ Microbiol. 69, 4455–4462. Walter NG, Schwille P, Eigen M (1996) Fluorescence correlation analysis of probe diffusion simplifies quantitative pathogen detection by PCR. Biochemistry 93, 12805–12810. Wang J, Li J, Baca AJ, Hu J, Zhou F, Yan W, Pang DW. (2003) Amplified voltammetric detection of DNA hybridization via oxidation of ferrocene caps on gold nanoparticle/streptavidin conjugates. Anal Chem. 753941–3945. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP (1997) Continuous fluorescence monitoring of rapid cycle DNA amplification. BioTechniques 22, 130–138. Wittwer CT, Herrmann MG, Gundry CN, Elenitoba-Johnson KSJ (2001) Real-Time Multiplex PCR Assays. Methods 25, 430–442. Wurz A, Bluth A, Zeltz P, Pfeifer C, Willmund R (1999) Quantitative analysis of genetically modified organisms (GMO) in processed food by PCR-based methods. Food Control 10, 385–389.

8 DNA-based Methods for Detection of Genetic Modifications Yoshimura T, Kuribara H, Matsuoka T, Kodama T, Iida M, Watanabe T, Akiyama H, Maitani T, Furui S, Hino A. (2005) Applicability of the quantification of genetically modified organisms to foods processed from maize and soy. J Agric Food Chem. 53, 2052–2059.

Zhang DY, Brandwein M, Hsuih TCH, Li HB (1998) Amplification of target-specific, ligation-dependent circular probe. Gene 211, 277–285. Zhou X, Zhou J. (2004) Improving the signal sensitivity and photostability of DNA hybridizations on microarrays by using dyedoped core-shell silica nanoparticles. Anal Chem. 76, 5302–5312.

185

9 Genetic Engineering of Fish, and Methods of Detection Hartmut Rehbein

9.1 Introduction

After the end of second world war there was a large and long-lasting increase in the exploitation of fisheries, which ended in the nineties. In 2003, according to FAO statistics, total production of fish, shrimps, and mollusks amounted to 131 × 106 tons, of which 32% was delivered by aquaculture [1]. Fish consumption varies considerably among countries; globally, fishery products are an important source of protein (~16%) for human nutrition [2]. The growing demand for high-quality seafood protein can be met only by a future increase of aquaculture, because exploitation of natural fisheries is at a maximum [3]. The genetic engineering of aquatic organisms may have great potential for expansion of farming of fish and shellfish to be used for human consumption [4]; there are also interesting possibilities of using transgenic fish as biofactories for production of pharmaceutical products [5–7]. Recently, in Singapore, transgenic zebra fish (Danio rerio) have been developed for use ornamentally or as bioreactors as a result of the abundant expression of green, red, or yellow fluorescent protein in the muscle of the fish [8]. The US Food and Drug Administration (FDA) has found no reason to regulate these particular fish, which are sold now to US consumers as a novel pet, called GloFish [9]. During the past decade great progress has been made in the development and farming of transgenic food fish, including the Atlantic salmon (Salmo salar). Indeed, Atlantic salmon carrying an “all-fish-gene cassette” consisting of an ocean pout (Macrozoarces americanus) antifreeze protein promoter coupled with the growth-hormone gene from the Pacific Chinook salmon (Oncorhynchus tshawytscha) [10, 11], may be the first transgenic animal marketed for human consumption. The US/Canadian company Aqua Bounty Farms has applied to the FDA for permission to market this salmon [12]. Several other transgenic fish species have also now been patented [13, 14]. Research into transgenic shellfish and mollusks is still in its early stages, because the genetic and metabolic background of these animals is not as well under-

9 Genetic Engineering of Fish, and Methods of Detection

stood as for fish [15] and hom*ologous gene promoters are rare. Because shrimp eggs are very fragile, in contrast with fish eggs, new methods must be used for delivery of DNA into shrimp zygotes [16]. Some progress has, nonetheless, recently been made in the transfer of genes into oyster embryos [17] and into the gonads of crustaceans [18] and other species [15, 16]. This chapter will focus on the production, detection, and food safety of genetically modified food fish. Topical information on ecological problems caused by farming of transgenic fish can be found elsewhere [19, 20]. Two recently published books on aquaculture biotechnology give comprehensive information about transgenic food fish [21, 22]. It should be kept in mind that a nonfood fish, the zebra fish (Danio rerio), is the fish species best known in respect of genome sequence, gene transcription, and protein expression [23]. The methodological tools developed for mutagenesis, reverse genetics, and permanent or transient transgenesis of zebra fish may be used in studies of food fish, e.g. enhancement of n − 3 polyunsaturated fatty acid biosynthesis by over-expression of the masu salmon Λ6-desaturase-like gene [83].

9.2 Development and Production of Transgenic Fish

Genetic engineering of fish has substantial advantages compared with traditional breeding technology. The introduction of specific genetic elements offers the possibility of reaching the desired goal in a relatively short time (i.e. within a few years); fast growing transgenic salmon, carp, catfish, and tilapia are prominent examples. By use of this approach, stable integration inheritance of the construct can be achieved within three to four generations. In addition to growth enhancement, the use of transgenic fish has several other advantages (Table 9.1), including better resistance against diseases and superior utilization of feed – both factors of major importance in the improvement of farmed fish production. Tab. 9.1 Benefits expected from transgenic fish [25, 26]. Acceleration of fish growth Increase of overall size Higher yield of fillet Increase of food conversion efficiency Superior utilization of carbohydrates as a low-cost diet Cold tolerance Freeze resistance Control of sex and reproduction Stress resistance Improved sensory properties (color, odor, flavor, taste, texture) Improvement of nutritional properties

187

188

9.2 Development and Production of Transgenic Fish Tab. 9.2 Examples of transgenic fish. Fish species

Characteristic

Refs

Carp, Cyprinus carpio

Enhanced growth

27–31

Silver sea bream, Sparus sarba

Enhanced growth

Ayu, Plecoglossus altivelis

Enhanced growth

Rohu, Labeo rohita

Enhanced growth

Channel catfish, Ictalurus punctatus

Enhanced growth

Mud loach, Misgurnus mizolepis

Enhanced growth

Tilapia, Oreochromis hornorum hybrid

Enhanced growth

Tilapia, Oreochromis niloticus

Enhanced growth

Rainbow trout, Oncorhynchus mykiss

Enhanced growth

Coho salmon, Oncorhynchus kisutch

Enhanced growth

37,38

Cutthroat trout, Oncorhynchus clarki

Enhanced growth

Chinook salmon, Oncorhynchus tshawytscha

Enhanced growth

Atlantic salmon, Salmo salar

Enhanced growth

11, 39

Arctic charr, Salvelinus alpinus

Enhanced growth

Channel catfish

Disease resistance

13, 46

Grass carp, Ctenopharyngodon idellus

Disease resistance

Atlantic salmon

Antifreeze protein

Rainbow trout

Biosynthesis of ascorbic acid

Rainbow trout

Better carbohydrate utilization

Arctic charr

Better carbohydrate utilization

Since Chinese scientists produced the first batch of fast-growing transgenic goldfish in 1984 [24], more than 30 fish species have been genetically modified in different countries including the USA, Canada, UK, Cuba, Israel, China, and Finland. Some examples of transgenic fish are given in Table 9.2.

9 Genetic Engineering of Fish, and Methods of Detection

9.2.1 Structure of Gene Cassettes

A typical “gene cassette” or “construct” consists of the following elements: — promoter — gene or cDNA — terminator — Two types of gene cassette have been used for transformation of fish. During the initial phases of these experiments, the elements of viral, bacterial, and cold or warmblooded animals were combined (a review has been published elsewhere [49]). The human growth hormone (GH) gene was also, originally, introduced into more than ten fish species; more recently it has been found preferable to fuse elements taken from other fish or even from the same species, for two reasons: 1. more efficient expression of the transgene; and 2. better consumer acceptance of transgenic fish. Some examples of constructs are listed in Table 9.3. Promoters of four fish genes were usually found to be very effective [50]: • the metallothionein promoter, which could drive growth hormone transgene expression in liver and many other cell types; • the antifreeze protein promoter; • the β-actin promoter; and • the sockeye salmon histone H3 promoter [51]. Growth enhancement was the first motive for construction of genetically modified fish; as a consequence growth hormone genes, i.e. their cDNA, were the central part of most of the gene cassettes. Terminators, which are necessary for correct termination of transcription, either came from the genes introduced, or had to be inserted when cDNA was used [10]. 9.2.2 Methods of Gene Transfer

Microinjection into fertilized eggs has been chosen by most groups to introduce constructs. The pros and cons of other techniques applied, for example electroporation, sperm-mediated transfer, and high-velocity microprojectile bombardment have also been discussed [50]. Sperm as a carrier has been used for gene transfer with and without electroporation [51]. Uptake and integration of transferred DNA was found to be substantially enhanced by use of noncovalent DNA–nuclear transport peptide complexes [52]. Pluripotent embryonic stem cells (ES) are a new alternative for generation of transgenic fish by cell-mediated gene transfer and targeted gene mutation. Development of ES cell lines of food fish (Chrysophrys major, Sparus auratus, Lateolabrax japonicus) has started recently [53–55].

189

190

9.2 Development and Production of Transgenic Fish Tab. 9.3 Gene cassettes used for construction of transgenic food fish. Gene cassette[*]

Fish species

Refs

P: Rous sarcoma virus long terminal repeat G: Rainbow trout growth hormone 1 cDNA

Carp, Cyprinus carpio

P: Mouse metallothionein G: Human growth hormone 1 gene

Carp, Cyprinus carpio

P: Carp β-actin G: Chinook salmon growth hormone cDNA

Carp, Cyprinus carpio

P: Carp β-actin G: Grass carp growth hormone gene

Carp, Cyprinus carpio

P: Giant silk moth Cecropin B G: Giant silk moth Cecropin B gene

Channel catfish, Ictalurus punctatus

P: Rous sarcoma virus long terminal repeat G: Rainbow trout growth hormone cDNA G: Coho salmon growth hormone cDNA

Channel catfish, Ictalurus punctatus

P: Cytomegalovirus G: Tilapia growth hormone cDNA T: Simian virus 40 poly A site

Tilapia, Oreochromis hornorum hybrid

P: Ocean pout antifreeze protein G: Chinook salmon growth hormone cDNA T: Ocean pout antifreeze protein 3′ region

Tilapia, Oreochromis niloticus

P : Tilapia L18 ribosomal protein promoter G: Tilapia growth hormone gene T: Tilapia poly (A) and termination signal

Tilapia, Oreochromis niloticus

P: Mud loach β-actin G: Mud loach growth hormone gene

Mud loach, Misgurnus mizolepis

P: Cytomegalovirus G: Sockeye salmon growth hormone 1

Arctic charr, Salvelinus alpinus

P: Cytomegalovirus G: Human glucose transporter type 1 cDNA T: Bovine growth hormone polyA site

Arctic charr, Salvelinus alpinus

P: Sockeye salmon metallothionein G: Rat hexokinase type II cDNA T: Sockeye salmon growth hormone 1

Arctic charr, Salvelinus alpinus

P: Sockeye salmon histone 3 G: Rat hexokinase type II cDNA T: Sockeye salmon growth hormone 1

Arctic charr, Salvelinus alpinus

P: Sockeye salmon metallothionein G: Human glucose transporter type 1 cDNA T: Sockeye salmon growth hormone 1

Arctic charr, Salvelinus alpinus

P: Sockeye salmon histone 3 G: Human glucose transporter type 1 cDNA T: Sockeye salmon growth hormone 1

Arctic charr, Salvelinus alpinus

9 Genetic Engineering of Fish, and Methods of Detection Tab. 9.3 (continued) Gene cassette[*]

Fish species

Refs

P: Cytomegalovirus G: Human glucose transporter type 1 cDNA T: Bovine growth hormone polyA site

Rainbow trout, Oncorhynchus mykiss

P: Sockeye salmon metallothionein G: Rat hexokinase type II cDNA T: Sockeye salmon growth hormone 1

Rainbow trout, Oncorhynchus mykiss

P: Sockeye salmon histone 3 G: Rat hexokinase type II cDNA T: Sockeye salmon growth hormone 1

Rainbow trout, Oncorhynchus mykiss

P: Sockeye salmon metallothionein G: Human glucose transporter type 1 cDNA T: Sockeye salmon growth hormone 1

Rainbow trout, Oncorhynchus mykiss

P: Sockeye salmon histone 3 G: Human glucose transporter type 1 cDNA T: Sockeye salmon growth hormone 1

Rainbow trout, Oncorhynchus mykiss

P: Cytomegalovirus G: Rat gulonolactone oxidase cDNA

Rainbow trout, Oncorhynchus mykiss

P: Sockeye salmon metallothionein G: Rat gulonolactone oxidase cDNA

Rainbow trout, Oncorhynchus mykiss

P: Cytomegalovirus G: Rat hexokinase type II cDNA

Rainbow trout, Oncorhynchus mykiss

P: Cytomegalovirus G: Human glucose transporter type 1 cDNA

Rainbow trout, Oncorhynchus mykiss

P: Sockeye salmon metallothionein-B G: Sockeye salmon growth hormone 1 gene

Rainbow trout, Oncorhynchus mykiss

P: Ocean pout antifreeze protein G: Chinook salmon growth hormone cDNA

Rainbow trout, Oncorhynchus mykiss

P: Ocean pout antifreeze protein G: Chinook salmon growth hormone cDNA

Cutthroat trout, Oncorhynchus clarki

P: Ocean pout antifreeze protein G: Chinook salmon growth hormone cDNA

Chinook salmon, Oncorhynchus tshawytscha

P: Sockeye salmon metallothionein B G: Sockeye salmon growth hormone 1 gene

Coho salmon, Oncorhynchus kisutch

P: Ocean pout antifreeze protein G: Chinook salmon growth hormone cDNA

Coho salmon, Oncorhynchus kisutch

P: Ocean pout antifreeze protein G: Chinook salmon growth hormone cDNA

Atlantic salmon, Salmo salar

11, 39

G: Winter flounder antifreeze protein gene

Atlantic salmon, Salmo salar

P, promoter; G, gene; T, terminator

191

192

9.2 Development and Production of Transgenic Fish

9.2.3 Evidence of Gene Transfer and Expression

The methods of gene transfer currently applied do not enable site-specific introduction of a single copy of a construct into the genome of the fish to be modified. Thus, an unpredictable number of constructs may be integrated into the genome of the host. Another complicating effect in the production of transgenic fish is mosaicism in the first generation [21]. Because the constructs normally do not integrate into the host genome before to the first division of the egg, a substantial number of cells of the embryo normally lack the transgene [21]. Hybridization techniques and polymerase chain reaction (PCR)-based methods have been used to follow the fate of introduced gene cassettes. For example, evidence was obtained by means of Southern blotting for antifreeze protein (AFP) gene-transfer to Atlantic salmon. DNA from two out of a group of thirty-two fingerlings gave positive hybridization signals when probed with a labeled AFP gene sequence [56]. The restriction pattern shown by the DNA was consistent with that of the injected DNA, indicating the nondegraded construct was present in the salmon. In other work Southern blotting was performed to identify uptake and integration of the OPAFPcsGH construct by tilapia, and to estimate the number of copies present in specimens of transgenic fish [35]. PCR offers many possible means of monitoring gene transfer by placing primers into different elements of the construct. The event of integration of the construct into the genome of the host can be detected by locating one primer in the genome of the host and the second in an element of the construct. For example, several PCR systems were used to screen Atlantic salmon for growth hormone transgenesis. The construct injected into the salmon consisted of an ocean pout antifreeze protein gene promoter linked to chinook salmon growth hormone cDNA, and as the terminator of the ocean pout antifreeze protein gene 3′ region (OPAFPcsGHc) [11]. By means of using different pairs of primers located in the promoter, gene and terminator, amplicons ranging in size from 199 to 855 base pairs (bp) could be produced. PCR results were also confirmed by hybridization with a GHcDNA probe. These PCR systems proved very convenient for identifying positive transgenic fish with the elements of the construct in the correct sequence [56]. In several experiments the transgenic fish did not have the characteristics expected from gene transfer. Examples are Atlantic salmon with AFP genes [56] and Arctic charr and rainbow trout which were supplied with two genes for more efficient utilization of carbohydrates [57]. Expression of the transferred growth hormone gene or antifreeze protein gene was analyzed by Northern blotting and reverse-transcribed (RT)-PCR of mRNA. Using the latter technique, GHmRNA was detected in liver, gill, spleen, and pituitary of transgenic Atlantic salmon [56]. The final product of the transgene – a peptide or protein – can be detected and characterized by commonly used methods of protein or enzymatic analysis. To test the efficiency of injection techniques or promoters, reporter genes coding for

9 Genetic Engineering of Fish, and Methods of Detection

fluorescent protein [58], chloramphenicol acetyl transferase, or β-galactosidase [59] have been used, because these gene products are easily detectable. Antifreeze protein has been measured in transgenic Atlantic salmon [56] and the level of growth hormone has been determined in genetically modified tilapia [60].

9.3 Examples of Successful Production of Transgenic Fish

In this section five species of transgenic fish which have been reared for several generations are described and characterized in some detail. 9.3.1 Atlantic Salmon

The transgenic Atlantic salmon is a prominent representative of the “blue revolution”, a term which denotes enhancement of the productivity of aquaculture by biotechnology to produce a sustainable food supply to feed the world’s growing population. Doubts have been expressed about whether the salmon is the correct species for this “revolution”. Other species, for example carp or tilapia, which consume low-cost plant feed, are better candidates for transgenic farmed fish in developing countries [61]. Approximately ten years ago it was reported that a dramatic increase in growth enhancement, on average three to fivefold, had been observed in transgenic Atlantic salmon carrying an “all-fish-gene cassette” [11]. This fish reaches commercial size (3–4 kg) in approximately half the time needed by standard nontransgenic salmon. The genetic modification, OPAFPcsGHc has been published in detail, as mentioned in the previous section. In the meantime several generations of hom*ozygous transgenic fish have been produced. Recently, in a series of three reports, the growth rate, body composition, feed digestibility and/or conversion, and other physiological properties of the F2 generation of growth-enhanced transgenic salmon have been reported [62–64]. Over a presmolt growth interval of 8–55 g, growth of the transgenic fish was nearly three times that of nontransgenic salmon, accompanied by a more than twofold increase in daily feed consumption. Coefficients of protein and energy digestibility were in the same range for transgenics and controls, but a 10% improvement in gross feed conversion efficiency was observed for transgenic salmon compared with control fish. Body protein, dry matter, ash, lipid, and energy were significantly lower in the transgenic salmon compared with controls whereas moisture content was substantially higher.

193

194

9.3 Examples of Succesful Production of Transgenic Fish

9.3.2 Pacific Salmon

Coho salmon (O. kisutch) is another example of extraordinary growth enhancement being achieved by introduction of a growth hormone gene, in this instance an “all-salmon gene cassette” [37]. The construct (pOnMTGH1) consisted of the metallothionein-B promoter fused to the full-length type 1 growth hormone gene, both from the sockeye salmon, O. nerka. Different aspects of the physiology and metabolism of transgenic coho have been studied during recent years to obtain more insight into the effects of elevated growth hormone levels. Extreme growth enhancement was accompanied by phenotypic effects. Transgenesis led to changes in body and head shape, with the dorsal caudal peduncle and abdominal regions being distinctly enlarged compared with controls [65]. It was also observed that transgenic coho salmon had a greater surface area of intestine compared with nontransgenics of the same size [66], but new results indicated that this effect was indirect – a consequence of greater feed intake [67]. Study of the muscle biochemistry and physiology of growth-enhanced transgenic coho salmon relative to older controls of the same size revealed several differences between the groups [68]. Compared with nontransgenic fish, the transgenics had more red muscle, greater numbers of small-diameter muscle fibers in both the dorsal and lateral regions of the somitic muscle, and higher phosphofructokinase and cytochrome oxidase activity in white muscle. Subtractive hybridization of muscle RNA of transgenic fish from control fish provided a library of cDNAs, the expression of which was up-regulated in the transgenic fish. By sequencing of some of the fragments, cDNAs similar to mRNAs of myosin light chain 2, β-parvalbumin, skeletal alpha-actin, and myosin heavy chain were identified. These differences in gene expression, with the above mentioned changes in muscle architecture and enzyme activity may affect meat quality. 9.3.3 Tilapia (O. hornorum hybrid)

Tilapia, which belong to the family Cichlidae, are warm-water fish feeding mainly on plants, but also on small invertebrates. At least ten of more than sixty tilapia species are consumed by humans. Intensive research on transgenic tilapia has been performed in the last decade in Cuba; this has resulted in transgenic lines with moderate growth acceleration without detrimental effects to the fish [69]. The tilapia were genetically modified using a construct containing the human cytomegalovirus 5′ regulatory sequences linked to the tilapia growth hormone cDNA and the polyadenylation site from simian virus 40: CMV-tiGh-CAT-SV40. The transgene was stably transmitted to F4 generations in a Mendelian fashion indicating that the gene cassette was integrated into the host genome. Under optimum rearing conditions, transgenic tilapia grew 60–80% faster than nontransgenic siblings, but under less favorable experimental conditions small or no differences in growth rate were also observed; similar results were obtained in

9 Genetic Engineering of Fish, and Methods of Detection

another study [70]. Food consumption by transgenic tilapia was a factor of approximately 3.6 less than for nontransgenic controls, but food conversion efficiency was significantly higher (290%). The efficiency of growth, protein synthesis retention, anabolic stimulation, and average protein synthesis were also enhanced in transgenic fish. In juvenile tilapia, but not in adult fish, glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) activity in transgenic fish was enhanced in muscle and reduced in liver, compared with controls. It was concluded that the GH-transgenic fish utilized energy released by oxidation of amino acids more efficiently [70]. 9.3.4 Tilapia (O. niloticum)

Another tilapia species, O. niloticum, was genetically modified by injecting the construct OPAFPcsGHc, which had also been used for production of transgenic Atlantic salmon (Section 9.3.1) [35]. Expression of Chinook salmon growth hormone resulted in considerable growth enhancement. The average weight of transgenic fish was three to fourfold greater than that of their nontransgenic siblings. Two growth and nutritional trials were performed to gain deeper insight into the physiological effects of the growth hormone gene transfer [71]. At seven months the mean mass of transgenic tilapia was 2.5-fold that of control fish. Significantly greater head: total length ratio, viscera-somatic index, and hepato-somatic index were observed in transgenic fish. Female and male gonado-somatic indices were found to be different for transgenics and controls. In a shorter-term growth performance trial transgenic tilapia were shown to be more efficient utilizers of protein, dry matter, and energy. Recently, new strains of auto-transgenic tilapia have been produced containing an “all-tilapia construct”, which consisted of a tilapia L18 ribosomal protein promoter fused to a tilapia growth hormone gene and poly (A) termination signal [72]. 9.3.5 Carp (C. carpio)

Carp production from aquaculture has increased from five million tons in 1990 to sixteen million tons in 2001. Cyprinid species are important sources of animal protein in many Asian countries [73]. Transgenic carp, C. carpio, have been produced by micro-injection into fertilized eggs of a construct consisting of the mouse metallothionein promoter fused to the human growth hormone 1 gene [28]. The growth rate of F4 generation transgenic carp fed diets of 20, 30, or 40% crude protein was 2 to 2.5-fold higher than for nontransgenic controls. Amounts of recovered protein were significantly higher for transgenics than for controls fed all diets, and recovered energy was substantially higher in transgenic fish fed the 40% protein diet. For fish fed each diet, the transgenics had higher body contents of dry matter and protein, but smaller amounts of lipids, than the controls.

195

196

9.5 Food Safety of Transgenic Fish

To increase the acceptability of transgenic carp to the Chinese consumer and government, autotransgenic carp have been developed and cultured in recent years [31]. The construct contained a β-actin promoter of common carp and a grass carp growth hormone gene. The construct was microinjected into fertilized eggs of Yellow River carp, a local strain of C. carpio. The growth rate was higher for transgenic carp than for control fish and feeding conversion efficiency was superior [74].

9.4 Methods of Detecting Processed Transgenic Fish

PCR-based methods have been published for detection of most of the transgenic fish described in Section 9.3. These methods have been used to differentiate fish carrying the construct from nontransgenics and can be used for identification of transgenic processed fish. Because DNA may be degraded in the fishery products, however, the fragments to be amplified should not be too long, i.e. less than 500 bp [75]. For example, a PCR-based method for identification of genetically modified coho salmon has recently been developed and evaluated in a collaborative study [76]. The coho salmon contained an “all-salmon” gene construct (OnMTGH1; Section 9.3.2). Two PCRs were performed; the first served as a control for amplifiable PCR (463-bp amplicon) present in the sample and at the same time as a tool for species identification using the PCR-restriction fragment length polymorphism (RFLP) test. The second PCR, working with primers located in the construct (one of the primers was located in the promoter, the other within the growth hormone gene) detected the genetic alteration. The amplicon of the second PCR was 427 bp in length, and this was confirmed by RFLP or sequencing. In a collaborative study with 15 laboratories the species and the genetic modification were always assigned correctly. Another study of detection of transgenic coho salmon dealt with optimization of DNA extraction and PCR conditions [77]. Amplification of a 155-bp sequence of coho growth hormone gene served as a control for the presence of DNA suitable for PCR, whereas the same primers as described above were used for detection of the construct.

9.5 Food Safety of Transgenic Fish

For evaluation of the food safety of growth hormone-transgenic fish, the principal of “substantial equivalence” may be applied. The OECD’s group of National Experts of Safety in Biotechnology came to the conclusion “that no issue could be identified which reduced or invalidated the application of the principle of substantial equivalence to food or food components derived from modern aquatic bio-

9 Genetic Engineering of Fish, and Methods of Detection

technology” [78]. This means that wild or farmed fish of the same species should be used for comparison. Fishery products made from transgenic fish should be evaluated on the basis of products made from nontransgenics. It was concluded that application of bioengineering does not, in itself, result in a special risk to the consumer. This position was recently confirmed by results from a study of safety considerations of DNA in food [79]. It is clear that transgenic fish containing “all-fish gene cassettes” will not pose any risk to the consumer arising from uptake of the construct. Neither could special risks (e.g. by integration of DNA into human or gut microflora genomes) be identified in instances where constructs consisted partly of nonfish elements. Uptake, degradation and metabolism of substantial amounts (100–1000 mg per person per day) of foreign DNA is a normal process in human life. The food safety of transgenic fish has been addressed in two publications [80, 81] and in a report of a FAO/WHO expert consultation on assessment of the safety of food derived from genetically modified animals including fish [82]. The consequences of eating foreign DNA has been considered above. Other aspects to be regarded in respect of health risks for consumers are: 1. the gene product; and 2. potential pleiotropic effects. 9.5.1 The Gene Product

Until now, in most instances of transgenic food fish production the gene product has been a fish growth hormone, either from the same species (e.g. for tilapia) or from another fish species. The evaluation of the safety of consuming tiGHtransgenic tilapia included a study of the effects of injection of recombinant tiGH into macaques, and a test of the in-vitro activity of tiGH on rabbit xiphoid cartilage bioassay [84]. From the results from both experiments the conclusion was drawn that tiGH had no effect on the metabolism of higher vertebrates and, especially, no biological activity in nonhuman primates. Furthermore, no adverse effects were detected in human healthy volunteers after short-term consumption of transgenic tilapia. Although the concentration of growth hormone in organisms is low, much higher concentrations of other proteins, for example lysozyme or antifreeze proteins, are needed for proper fulfillment of their function [56]. Transgenic fish containing enhanced amounts of these proteins should be analyzed to determine the allergic properties of these proteins [85]. These proteins occur naturally in several fish species but may not be expected in others. If there is any suggestion they have allergenic potential, correct labeling of transgenic fish will be mandatory.

197

198

References

9.5.2 Pleiotropic Effects

These are defined as indirect changes of the phenotype (metabolism, composition, appearance) as a consequence of altering a gene. Pleiotropic effects have been found in studies of the physiology of transgenic coho salmon (Section 9.3.2). Enhanced gene expression of parvalbumin, a well known major human allergen in food fish, was identified as a potential risk to consumer health [68]. Pleiotropic effects should be considered very seriously if transgenic fish are to be produced from species which contain (naturally) undesired or even toxic compounds, or if such compounds are produced during processing and storage. For example, gadoid fish (e.g. cod, Gadus morhua) have trimethylamine oxide demethylase activity which can lead to the formation of formaldehyde and dimethylamine during frozen storage of the products [86]. Some other fish species (e.g. scombroids) contain large amounts of imidazole compounds, precursors of biogenic amines, in the fillet. Pleiotropic effects may be less serious than expected with regard to toxins [81]. Some toxic fish species (e.g. puffer fish) do not produce toxins endogenously, although this has not been proved for all the species used for human consumption. The skin or mucus of redfish (Sebastes spp.) and eel (Anguilla spp.) contain toxic proteins whose origin and properties are largely unknown [87]. More than 200 species of marine fish, including stingrays, some species of shark, and catfish, are known or suspected to be venomous [88].

References 1 FAO Fishstat Plus. Rome 2005. 2 FAO Aquaculture Production Statistics 1984–1993. Rome, 1995. 3 D. Zeller, D. Pauly. Fish and Fisheries 2005, 6, 156–159. 4 J. de la Fuente, F.O. Castro (eds.), Gene Transfer in Aquatic Organisms, Springer, Berlin, 1998. 5 G. Hwang, F. Müller, M.A. Rahmann, D.W. Williams, P.J. Murdock, K.J. Pasi, G. Goldspink, H. Farahmand, N. Maclean. Marine Biotechnology 2004, 6, 485–492. 6 T. Morita, G. Yoshizaki, M. Kobayashi, S. Watabe. Transgenic Research 2004, 13, 551–557. 7 B. Pohajdak, M. Mansour, O. Hrytsenko, J.M. Colon, L.C. Dymond. Transgenic Research 2004, 13, 313–323. 8 Z. Gong, H. Wan, T.L. Tay, H. Wang, M. Chen, T. Yan. Biochemical Biophysical Research Communications 2003, 308, 58–63.

9 www.glofish.com. 10 S.J. Du, Z. Gong, C.H. Tan, G.L. Fletcher, C.L. Hew. Mol. Mar. Biol. Biotech. 1992, 1, 290–300. 11 S.J. Du, Z. Gong, G.L. Fletcher, M.A, Shears, M.J. King, D.R. Idler, C.L. Hew. Bio/Technology 1992, 10, 176–181. 12 T. Reichhardt. Nature 2000, 406, 10–12. 13 R.K. Cooper, F.M. Enright, US Patent No. 5,998,698. 14 N.G. McKeown Sherwood, D. B. Parker,, J.E. McRory, D.W. Lescheid. US Patent No. 5,695,954. 15 M. Gomez-Chiarri, G.J. Smith, J. De la Fuente, D.A. Powers, in: Gene Transfer in Aquatic Organisms (J. de la Fuente, F.O. Castro, eds.), Springer, Berlin, 1998, 107–125. 16 P.S. Sun, N.C. Venzon JR, F.R.O. Calderon, D.M. Esaki. Aquaculture 2005, 243, 19–26.

9 Genetic Engineering of Fish, and Methods of Detection 17 J.T. Buchanan, A.D. Nickens, R.K. Cooper, T.R. Tiersch. Mar. Biotechnol. 2001, 3, 322–335. 18 A. Sarmasik, C.Z. Chun, I.K. Jang, J.K. Lu, T.T. Chen. Mar. Biotechnol. 2001, 3, S177–S184. 19 Future Fish-Issues in Science and Regulation of Transgenic Fish. A report prepared for the Pew Initiative on Food and Biotechnology. Washington D.C., 2003. www.pewagbiotech.org. 20 W.M. Muir. EMBO Reports 2004, 5, 654–659. 21 R.A. Dunham. Aquaculture and Fisheries Biotechnology-Genetic Approaches. 2004, CABI Publishing, Wallingford, UK. 22 T.J. Pandian, C.A. Strüssmann, M.P. Marian (eds), Fish Genetics and Aquaculture Biotechnology, 2005, Science Publishers Inc., Enfield (NH), USA. 23 C. The, S. Parinov, V. Korzh. Biotechniques 2005, 38, 897–906. 24 Z. Zhu, G. Li, L. He, S. Chen. J. Appl. Ichthyol. 1985, 1, 31–34. 25 P. Melamed, Z. Gong, G. Fletcher, C.L. Hew. Aquaculture 2002, 204, 255–269. 26 N. Maclean. Trends Food Science Technology 2003, 14, 242–252. 27 N. Chatakondi, R.T. Lovell, P.L. Duncan, M. Hayat, T.T. Chen, D.A. Powers, J.D. Weete, K. Cummins, R.A. Dunham, Aquaculture 1995, 138, 99–109. 28 C. Fu, Y. Cui, S.S.O. Hung, Z. Zhu, J. Fish Biol. 1998, 53, 115–129. 29 Y. Hinits, B. Moav, Aquaculture 1999, 173, 285–296. 30 B. Wu, Y.H. Sun, Y.W. Wang, Y.P. Wang, Z.Y. Zhu. Cell Research 2005, 15, 447–454. 31 C. Fu, W. Hu, Y. Wang, Z. Zhu. Rev. Sci. Tech. Off. Int. Epiz. 2005, 24, 299–307. 32 R.A. Dunham, A.C. Ramboux, P.L. Duncan, M. Hayat, T.T. Chen, C.M. Lin, K. Kight, I. Gonzalez-Villasenor, D.A. Powers. Mol. Mar. Biol. Biotechnol. 1992, 1, 380–389. 33 Y. K. Nam, J.K. Noh, Y.S. Cho, H.J. Cho, K.-N. Cho, C.G. Kim, D.S. Kim. Transgenic Res. 2001, 10, 353–362. 34 J. de la Fuente, I. Guillen, R. Martinez, M.P. Estrada. Genetic Analysis: Biomolecular Engineering 1999, 15, 85–90. 35 M.A. Rahman, N. Maclean. Aquaculture 1999, 173, 333–346.

36 R.H. Devlin, C.A. Biagi, T.Y. Yesaki, D.E. Smailus, J.C. Byatt. Nature 2001, 409, 781–782. 37 R.H. Devlin, T.Y. Yesaki, C.A. Biagi, E.M. Donaldson, P. Swanson, W.-K. Chan Nature 1994, 371, 209–210. 38 R.H. Devlin, T.Y. Yesaki, E.M. Donaldson, A.J. Du, C.-L. Hew. Can. J. Fish. Aquat. Sci. 1995, 52, 1376–1384. 39 C.L. Hew, G.L. Fletcher. 1996, US Patent No. 5,545,808. 40 A. Krasnov, J.J. Agren, T.I. Pitkänen, H. Mölsä. Genetic Analysis: Biomolecular Engineering 1999, 15, 99–105. 41 C.L. Hew, P.L. Davies, G. Fletcher. Mol. Mar. Bio. Biotechnol. 1992, 1, 309–317. 42 A. Krasnov, T.I. Pitkänen, H. Mölsä. Genetic Analysis: Biomolecular Engineering 1999, 15, 315–319. 43 T.I. Pitkänen, A. Krasnov, M. Reinisalo, H. Mölsä, Aquaculture 1999, 173, 319–332. 44 J. Zhong, Y. Wang, Z. Zhu. Aquaculture 2002, 214, 93–101. 45 J.-K. Lu, B.-H. Fu, J.-L. Wu, T.T. Chen. Marine Biotechnology 2002, 4, 328–337. 46 R.A. Dunham, G.W. Warr, A. Nichols, P.L. Duncan, B. Argue, D. Middleton, H. Kucuktas. Marine Biotechnology 2002, 4, 338–344. 47 C.-A. Cheng, K.-L. Lu, E.-L. Lau, T.-Y. Yang, C.-Y. Lee, J.-L. Wu, C.-Y. Chang. Zoological Studies 2002, 41, 303–310. 48 T. Venugopal, V. Anathy, S. Kirankumar, T.J. Pandian. J. Experimental Zoology 2004, 301A, 477–490. 49 T.J. Pandian, L.A. Marian, Current Science 1994, 66, 635–649. 50 T.J. Pandian, T. Venugopal. Contribution to Transgenesis in Indian Major Carp Labeo rohita. In: T.J. Pandian, C.A. Strüssmann, M.P. Marian (eds), Fish Genetics and Aquaculture Biotechnology, 2005, Science Publishers Inc., Enfield (NH), USA, 1–20. 51 W.-K. Chan, R.H. Devlin. Mol. Mar. Biol. Biotechnol 1993, 2, 308–318. 52 M.-R. Liang, P. Aleström, P. Collas. Mol. Reprod. Dev. 2000, 55, 8–13. 53 S.-L. Chen, H.-Q. Ye, Z.-X. Sha, Y. Hong. J. Fish. Biol. 2003, 63, 795–805. 54 J. Bejar, Y. Hong, M.C. Alvarez. Transgenic Research 2002, 11, 279–289. 55 S.-L. Chen, Z.-X. Sha, H.-Q. Ye. Aquaculture 2003, 218, 141–151.

199

200

References 56 C.L. Hew, G.L. Fletcher, P.L. Davies. J. Fish Biol. 1995, 47 (Supplement A), 1–19. 57 A. Krasnov, T.I. Pitkänen, H. Mölsä. Genetic Analysis: Biomolecular Engineering 1999, 15, 115–119. 58 K. Hamada, K. Tamaki, T. Sasado, Y. Watai, S. Kani, Y. Wakamatsu, K. Ozato, M. Kinosh*ta, R. Kohno, S. Takagi, M. Kimura. Mol. Mar. Biol. Biotechnol. 1998, 7, 173–180. 59 I. Guillen, R. Lleonart, D. Garcia del Barco, R. Martinez, F. Herrera, A. Morales, M.T. Herrera, R. Morales, J. de la Fuente. Biotecnologica Aplicada 1996, 13, 279–283. 60 R. Martinez, M.P. Estrada, J. Berlanga, I. Guillen, O. Hernandez, E. Cabrera, R. Pimentel, R. Morales, F. Herrera, A, Morales, J.C. Pina, Z. Abad, V. Sanchez, P. Lelamed, R. Lleonart, J. de la Fuente. Mol. Mar. Biol. Biotechnol. 1996, 5, 62–70. 61 R.A. Dunham. J. World Aquacult. Soc. 1999, 30, 1–11. 62 J.T. Cook, M.A. McNiven, G.F. Richardson, A.M. Sutterlin. Aquaculture 2000, 188, 15–32. 63 J.T. Cook, M.A. McNiven, G.F. Richardson, A.M. Sutterlin. Aquaculture 2000, 188, 33–45. 64 J.T. Cook, M.A. McNiven, G.F. Richardson, A.M. Sutterlin. Aquaculture 2000, 188, 47–63. 65 T.O. Ostenfeld, E. McLean R.H. Devlin. Journal of Fish Biology 1998, 52, 850–854. 66 E.D. Stevens, R.H. Devlin. J. Fish Biol. 2000, 56, 191–195. 67 E.D. Stevens, R.H. Devlin. J. Fish Biol. 2005, 66, 1633–1648. 68 J.A. Hill, A. Kiessling, R.H. Devlin. Can. J. Fish. Aquat. Sci. 2000, 57, 939–950. 69 J. de la Fuente, R. Martinez, I. Guillen, M.P. Estrada, R.Lleonart. In: Gene Transfer in Aquatic Organisms (eds. J. de la Fuente, F.O. Castro), Springer, Berlin 1998, 83–105. 70 R. Martinez, J.Juncal, C. Zaldivar; A. Arenal, I. Guillen, V. Morera, O. Carrillo, M. Estrada, A. Morales, M.P. Estrada. Biochem. Biophys. Res. Commun. 2000, 267, 466–472. 71 M.A. Rahman, A. Ronyai, B.Z. Engidaw, K. Jauncey, G.-L- Hwang, A. Smith, E. Roderick, D. Penman, L. Varadi, N. Maclean. J. Fish Biol. 2001, 59, 62–78.

72 N. Maclean, M.A. Rahman, F. Sohn, G. Hwang, A. Iyengar, H. Ayad, A. Smith, H. Farahmand. Gene 2002, 295, 265–277. 73 D.J. Penman, M.V. Gupta, M.M. Dey (eds.). Carp Genetic Resources for Aquaculture in Asia. World Fish Center, Penang, Malaysia, 2005. 74 G. Wu, Y. Sun, Z. Zhu. Aquatic Living Resources 2003, 16, 416–420. 75 P. Bossier. J. Food Sci. 1999, 64, 189–193. 76 H. Rehbein, R.H. Devlin, H. Rüggeberg. Eur. Food Res. Technol. 2002, 214, 352–355. 77 S. Masri, H. Rast, T. Ripley, D. James, M. Green, X. Jia, R.H. Devlin. J. Agric. Food Chem. 2002, 50, 3161–3164. 78 Anonymous, Aquatic Biotechnology and Food Safety, 1994, OECD, Paris. 79 D.A. Jonas, I. Elmadfa, K.-H. Engel, K.J. Heller, G. Kozianowski, A. König, D. Müller, J.F. Narbonne, W. Wackernagel, J. Kleiner. Ann. Nutr. Metab. 2001, 45, 235–254. 80 D.B. Berkowitz, I. Kryspin-Sorensen. Bio/Technol. 1994, 12, 247–252. 81 I. Kryspin-Sorensen, D. Berkowitz. Intern. J. Food Sci. Nutr. 1993, 44 (Suppl. 1), S17–S21. 82 Anonymous. Safety Assessment of Foods Derived from Genetically Modified Animals, Including Fish. Food and Nutrition Paper No. 79, FAO, Rome 2004. 83 A.G. Yoshizaki, V. Kiron, S. Satoh, T. Takeuchi. Transgenic Research 2005, 14, 159–165. 84 I. Guillen, J. Berlanga, C.M. Valenzuela, A. Morales, J. Toledo, M.P. Estrada, P. Puentes, O. Hayes, J. de la Fuente, Mar. Biotechnol. 1999, 1, 2–14. 85 S.L. Taylor, J.A. Nordlee, Food Technol. 1996, 50, 231–234, 238. 86 H. Rehbein, W. Schreiber, Comp. Biochem. Physiol. 1984, 79B, 447–452. 87 G. Marcuse, F. Marcuse Giftige und gefährliche Tiere der Meere, Landbuch, 1989. 88 J.E. Church, W.C. Hogson. Toxicon 2002, 40, 1083–1093. 89 A. Krasnov, T.I. Pitkänen, M. Reinisalo, H. Mölsä. Marine Biotechnology 1999, 1, 25–32.

10 Detection Methods for Genetically Modified Crops Rolf Meyer

10.1 Introduction

With the introduction of food derived from genetically modified organisms (GMO) – the first products became commercially available in Europe in 1996 – there has been an increasing need for appropriate analytical methods to monitor compliance with the strict regulations in the European Union (EU) and other regions [1]. Today, more than 50 different GM plants have been generated and produced, mostly in the USA, with the trend increasing. For most purposes, a screening or identification step might be sufficient to determine whether a product contains a GMO but the so-called “threshold regulation” specifies that foodstuffs must be subjected to labeling when material derived from these GMOs is present in food ingredients at a level greater than 0.9% of the food ingredients individually considered. This requires semi-quantitative analysis of GMOs in each ingredient to ascertain whether they are present at >0.9%, which would require labeling, or <0.9%, which would not. Different procedures must therefore be considered to distinguish “identity preserved” (IP) non-GM soya, for example, from soya containing proportions of GM soya in processed food products. Accurate determination of the proportion of GM soya is required and it would be necessary to perform quantitative analysis on the ingredients themselves before incorporation into the processed food. In general, three distinct steps are needed – detection, identification, and quantitation. Screening methods that provide a positive or negative statement can be used to determine if a product contains a GMO. Assays on raw material are usually performed with the polymerase chain reaction (PCR) or with immunological assays, for example enzyme-linked immunoassay (ELISA). Immunological assays are based on the specific binding between an antibody and the expressed transgenic protein, for example neomycin phosphotransferase II (NptII), the enzyme 5-pyruvylshikimate-3-phosphate synthase (EPSPS), or numerous Cry proteins (Bt, Bacillus thuringiensis, insecticidal endotoxin). If no protein is expressed from introduced DNA, this technique cannot be applied. Proteins are denatured during food

202

10.2 isolation of plant DNA

processing (i.e. thermal treatment) and any conformational change in the epitope structure of the protein renders the test ineffective. Immunological methods are therefore only suitable for raw material analysis. Because DNA is much more thermally stable than protein and can survive food processing, processed foods are usually analyzed with PCR methods. A food product might even have undergone such extensive processing that ingredients of potential GMO origin are no longer detectable. Detection of DNA and/or protein become difficult in highly refined ingredients, for example starch, lecithin, sugar, or vegetable oils. Before GMO identification or screening the presence of amplifiable DNA in a food matrix must be determined using universal or plant species-specific PCR assays (i.e. soya, maize, potato, tomato, or rapeseed-specific). If plant DNA is present and the screening result is positive, further analysis is required to determine whether the GMO is authorized within the EU or in regions with different regulations (e.g. Switzerland, Japan) and at what concentration the GMO is present in the food ingredients (determination of the level of GMO is required) [2, 3]. In the identification and quantification of GM crops there are several difficulties. In particular, the ploidy status of the chromosomes in cells and the number of integrated copies of the genetic modification are often unknown. The same transgenic construct (“cassette”) could be used in different plant species, for example maize and soybean, and the use of different “cassettes” in the same GM crop to combine GM traits (known as “stacked” genes – e.g. maize Mon810 × T25 from Pioneer) could lead to ambiguous results. The development of methods is hampered by the availability of certified GM crop reference material and access to GM-free material (e.g. from the same parent line). This chapter gives an overview of analytical methods for DNA which may be needed to detect the presence of genetically modified (GM) crops or for analysis of GM crop-derived produce. This discussion of detection of recombinant DNA in food by PCR is divided into three main steps – DNA extraction, amplification by PCR, and verification of the PCR products [4].

10.2 Isolation of plant DNA 10.2.1 Sampling

One of the major problems in analytical testing is the sampling procedure. A sample must be representative of the batch/lot of the product from which it was taken. The sampling plan and sample size must meet statistical requirements in respect of hom*ogeneity and threshold limit up to which the result should be reliable. Sampling plans for cereals and pulses are described in ISO 13690 [5]. Raw materials (soya beans, maize kernels) are often not systematically mixed during harvest, storage, transport, etc. whereas for processed ingredients (flour, protein isolate, lecithin, and starch) the variance is less, although batch-to-batch variation

10 Detection Methods for Genetically Modified Crops

must also be considered. The heterogeneity of a sample and the threshold set for acceptance of the presence of GM material will define both the number of samples taken and the appropriate sample size. The greater the heterogeneity, the more critical will be the choice of the appropriate sampling plan. For detection of low levels of GM material the sample size required will, to be representative, increase accordingly. The United States Department of Agriculture (USDA), Grain Inspection, Packers and Stockyards Administration (GIPSA, Washington DC) has established sampling guidelines for diagnostic testing of GM grain [6]. Harmonization of sampling procedures for GMOs and derived products is expected in the future (CEN working group 11; ISO/DIS 21568:2005) [7]. Recommendation 2004/747 [8] of the Commission of the European Communities includes paragraphs about sampling and detection methods. 10.2.2 Sample Preparation

Practical approaches for hom*ogenization of samples are described in the Swiss Food Manual [9], using soya and maize products as examples. Seven hundred grams of soy beans (whole beans or dehulled) or approximately 1 kg maize kernels should be incubated with 1500, or 2100 mL, respectively, of sterile water for up to 20 h and then hom*ogenized in a blender (Table 10.1). Thirty grams of dry samples (soya flakes, soya flour) should be incubated with 60 mL sterile water and hom*ogenized in a Stomacher or blender. Thirty grams of wet samples (tofu, soya sausage) should be hom*ogenized directly and liquid samples (e.g. soya drink) should be shaken thoroughly before weighing. hom*ogenous reference material, for example certified reference material (CRM) in the range 0.1–5% GM soya or GM maize flour produced by the Institute for Reference Materials and Measurements (IRMM), Belgium, does not require further hom*ogenization. To avoid cross-contamination between samples, disposable material and decontamination solution (e.g. hypochlorite solution and HCl or commercial products that destroy DNA) are recommended. Cross-contamination by dust should be avoided by physical separation of sample-preparation areas. Tab. 10.1 Recommended size of laboratory sample in relation to the hom*ogeneity of distribution of GM particles in the lot investigated (3500 particles) at 1% threshold for GMOs, according to Ref. [9]. Crop

Kernel (particles) weight

Sample size

Soy beans

0.2 g

700 g

Maize kernels

0.3 g

1050 g

Soya or maize grits

50 mg

126 g

Soya or maize flour

<1 mg

<2.6 g

203

204

10.2 isolation of plant DNA Sample preparation 1.

Weigh 30 g of dry sample (soya flakes, soya flour) and incubate with 60 mL sterile water for 20 min.

hom*ogenise in a blender or stomacher for 5 min.

DNA isolation and purification 1.

Weigh 100 mg sample and add 1.5 mL CTAB buffer.

Vortexmix and incubate at 65° C fo r at least 60 min.

Centrifuge at 15,000 × g for 10 min

Add 700 μL supernatant to 700 μL chloroform and vortexmix.

Centrifuge at 15,000 × g for 10 min.

Pipette 400 μL supernatant into 2 mL binding buffer.

Mix and load on silica-membrane column.

Wash twice with 750 μL wash buffer.

Dry columns by centrifugation at 12,000 × g for 5 min.

10. Elute DNA with 50 μL elution buffer by centrifugation at 12,000 × g for 5 min after 5 min incubation.

PCR analysis and verification

Fig. 10.1 Typical example of a samplepreparation and DNA-isolation procedure. The analytical flow sheet describes a method for extraction of DNA from plant raw materials and processed food samples. Based on a modification of a CTAB-DNA extraction method [10], it combines the convenience of

spin-column technology with the selective binding properties of silica gel membranes. In the presence of high salt concentration the DNA is adsorbed by the silica membrane while potentially interfering substances pass through the column. Impurities are washed away and the DNA is eluted.

10.2.3 DNA Extraction and Analysis

Assuming the laboratory sample is representative of the field sample and that it has been adequately hom*ogenized, even small aliquots of vegetable material or products, usually between 100 and 350 mg, are sufficient for DNA extraction. The efficiency of PCR depends on DNA quality and purity. DNA quality is determined by its fragment length and the extent of damage by exposure to heat, low pH, and/ or nucleases that cause hydrolysis, depurination, and/or enzymatic degradation. DNA quality therefore varies depending on the material under examination, the amount of processing of the food sample, and the DNA extraction method applied.

10 Detection Methods for Genetically Modified Crops

DNA isolated from processed ingredients and foods is of low quality, with available targets sequences being rather short, in the range of 100–400 bp (base pairs) for soya protein preparations and processed tomato products. An appropriate choice of primers to obtain short amplicons should therefore be made. Various components of the food matrix affect the purity of the DNA; examples include polysaccharides, lipids, and polyphenols or chemicals used during the DNA extraction procedure. The key enzyme of the PCR, Taq polymerase, is inhibited by polysaccharides, EDTA, phenol, SDS, and many other compounds. A vast range of methods is available for isolation of DNA and many have been evaluated for their applicability to GMO detection in plant material and plantderived food products [3]. Three different approaches to DNA isolation from plant material and plant-derived products are currently favored for GMO detection – the CTAB method [10], DNA-binding silica columns (various commercially available kits), and a combination of these (Fig. 10.1). The use of CTAB as detergent in the DNA extraction buffer is efficient for a wide range of plant materials and plantderived foods, especially because of good separation of polysaccharides from the DNA. Adapted procedures for starch (enzymatic treatment with α-amylase) and lecithin (use of a hexane extraction step to remove lipids) have been developed to improve the yield and quality of DNA from these matrices [11, 12]. The quantity and purity of the DNA is usually estimated by measuring the absorbance at 260 nm and at 280 nm by means of a spectrophotometer. Absorbance of 1 unit at 260 nm corresponds to a concentration of 50 μg double-stranded DNA mL−1 or 37 μg single-stranded DNA mL−1 (when denatured with 0.2 M NaOH) [9]. The ratio between the absorbance values at 260 nm and 280 nm gives an estimate of DNA purity – pure DNA usually has an A260/A280 ratio from 1.7 to 1.9. A higher A260/A280 ratio is indicative of RNA contamination whereas a lower ratio results from contamination with proteins. Alternatively, the DNA concentration is estimated by measurement fluorescence induced by reagents such as Pico Green (Molecular Probes, USA). The approximate amount of DNA and the average fragment size of DNA isolated from processed food samples is estimated on agarose gel stained with ethidium bromide or fluorescent nucleic acid gel stains. Contamination of the DNA with RNA can occasionally lead to overestimation of the DNA content if no RNase treatment is performed. Usually 5 to 100 ng DNA is used in PCR analysis. The DNA content in low-DNA-containing matrices, for example lecithin and starch, cannot be measured directly.

10.3 Detection Strategies

PCR methods in different formats (single or nested PCR; PCR–ELISA, QC–PCR, real-time PCR) are available and have found broad application in GMO detection (as reviewed by Anklam et al. [3]).

205

206

10.3 Detection Strategies

10.3.1 Screening

Introduced DNA elements common to several GM crops are, for example, the cauliflower mosaic virus (CaMV) promoter (P-35S), the 5-enol-pyruvylshikimat-3phosphate synthase (EPSPS) gene, the gene coding for CryIA(b) toxin from Bacillus thuringiensis, phosphinothricin acetyltransferase (pat/bar) genes from Streptomyces spp., the Agrobacterium tumefaciens nopaline synthase terminator (nos5), and the neomycin phosphotransferase gene (nptII), a selection marker for transformation of plant cells that confers resistance to kanamycin. For routine screening purposes, control laboratories are focusing on target sequences that are present in many (but not in all) GM crops currently on the market, for example the CaMV 35S promoter, the nos5 terminator, and nptII. An overview of the suitability of potential screening methods for detection of a selection of GM crops is given in Table 10.2 [13].

Tab. 10.2 Applicability of potential screening methods for detection of genetically modified crops (selection) based on Agbios database (www.agbios.com) [13] and additional data. Crop

Trade name event or line

Company

Genetic modification[+]

Presence of 35Spromoter

Presence of nos5terminator

Presence of nptII gene

Maize[*]

Maximizer Bt-176

Syngenta Seeds

Yes

Maize[*]

Bt-11

Syngenta Seeds

Yes

Maize

Bt Xtra DBT 418

Dekalb Genetics

IR, HT

Yes

Maize[*]

LibertyLink T25

Aventis CropScience (formerly AgrEvo)

Yes

Maize[*]

StarLink CBH-351

Aventis

Yes

Maize

Roundup Ready GA21

Monsanto

Yes

Maize

Roundup Ready NK603

Monsanto

Yes

Maize[*]

Yieldgard Mon 810

Monsanto

Yes

Yes[**]

10 Detection Methods for Genetically Modified Crops Tab. 10.2 (continued) Crop

Trade name event or line

Company

Genetic modification[+]

Presence of 35Spromoter

Presence of nos5terminator

Presence of nptII gene

Soybean[*]

Roundup Ready GTS 40-3-2

Monsanto

Yes

Cotton

BXN cotton

Calgene

Yes

Calgene

HT, IR

Yes

Cotton Cotton

19-51A

Du Pont

Cotton

Bollgard, Ingard

Monsanto

Yes

Cotton

Roundup Ready

Monsanto

Yes

Rapeseed

LibertyLink Innovator, HCN92

Aventis

Yes

Rapeseed

MS8 × RF3

Aventis (formerly Plant Genetic Systems)

HT, MS

Yes

Rapeseed

23-18-17, 23-198

Calgene

PQ1

Yes

Rapeseed

Roundup Ready

Monsanto

Potato[*]

NewLeaf

Monsanto

Yes

Potato

NewLeaf Y

Monsanto

IR, VR

Yes

Potato[*]

Russet Burbank, NewLeaf Plus

Monsanto

IR, VR

Yes

(Yes)

Tomato[*,***] Flavr Savr (MacGregor)

Calgene

PQ2

Yes

Tomato[*,***]

Zeneca Seeds

PQ2

Yes

DNA plant Technology

PQ2

Yes

[*]

[***]

Tomato

1345-4

207

208

10.3 Detection Strategies Tab. 10.2 (continued) Crop

Trade name event or line

Company

Genetic modification[+]

Presence of 35Spromoter

Presence of nos5terminator

Presence of nptII gene

Squash

Freedom ZW20

Upjohn/ Seminis Vegetable

Yes

Squash

Freedom CZW-3

Asgrow/ Seminis Vegetable

Yes

Cornell University

Yes

Bejo Zaden BV

MS, HT

Yes

Papaya

Chicory

* ** ***

Radicchio Rosso

based on experimental data obtained from reference material size of amplicon is approximately 325 to 350 bp tomato concentrate or tomato ketchup are highly acidic which may lead to negative results because of DNA degradation IR, insect-resistant; HT, herbicide-tolerant; MS, male sterile; VR, virus-resistant; PQ1, new product quality – altered fatty acid profile; PQ2, new product quality – delayed fruit ripening ( ) indicates not present in all lines

Screening for the CaMV 35S promoter alone is not sufficient and additional target sequences, a combination with transgene-specific genes (nptII, nos, EPSPS, pat/ bar, CryIA(b)) are needed to screen for a wider range of GM crops. 10.3.2 Specific Detection

Unequivocal identification of GM crops must be based on target sequences characteristic of each transgenic organism. This can be achieved by selection of primers to target introduced DNA that spans over the boundary of two adjacent genetic elements (e.g. promoters, structural genes, terminators) or cross-borders (junction regions) between insert and plant DNA (event-specific). Detailed knowledge of the gene organization and DNA sequences of the inserted transgenic constructs is required for design of appropriate primers for a PCR-based detection strategy, however. Three different detection strategies: screening, construct, and event-specific detection have been used to detect and identify Roundup Ready soybeans. A schematic presentation of these strategies is given in Fig. 10.2. Numerous detection methods have been included in a database of commercialized genetically

10 Detection Methods for Genetically Modified Crops

modified foods that gives detailed information about analytical conditions and the references to the original publication and validation data [14]. Demonstration of the presence of amplifiable DNA in a food matrix using universal or plant species-specific PCR assays is recommended before any screening or GM crop identification [15–26], as shown in Table 10.3. The presence or absence of DNA originating from soya extracted from highly processed food can be checked by use of soya-specific PCR systems, for example lectin Le1 (single copy gene) [15]. Other control PCR systems have been described for maize DNA (zein gene, alcohol dehydrogenase, high mobility group protein, or maize invertase) [16, 17, 26], potato (patatin gene) [18], and rapeseed (acetyl-CoA carboxylase, cruciferin, and napin) [20, 21], and also for the natural presence of CaMV in infected vegetables [22], for example Broccoli (Table 10.3). Plant-specific genes are used as a reference for qualitative and quantitative PCR detection of GM crops in mixed food samples.

Tab. 10.3 PCR-based detection methods used as control systems for amplifiable DNA from food matrices. Target organisms, specificity

Target sequence (gene)

Refs

Eukaryotes Vertebrates Plants Soya Soya Soya Maize Maize Maize Maize Potato Wheat Rapeseed Rapeseed CaMV

18S rRNA mtDNA (cytb gene) cpDNA (tRNA gene) Lectin gene, le1 Lectin gene, le1 Soy heat-shock protein gene, HSP Zein (methionine-rich storage protein) Invertase, ivr1 Alcohol dehydrogenase, adh1 High mobility group protein, (hmga) Patatin 25S-18S rRNA Acetyl-CoA Carboxylase (BnACCg8) Cruciferin and Napin ORF V and ORF VI

22 23 24 15 12 25 16, 26 17, 26 26 26 18 22 19 20 21

CaMV = cauliflower mosaic virus cpDNA = chloroplast DNA mtDNA = mitochondrial DNA

209

210

10.3 Detection Strategies nos3´terminator

plant DNA

CP4 EPSPS

CTP

E35Spromoter

plant DNA

PCR systems in different formats (qualitative and quantitative)

n amplicons

Event specific

Screening (nos)

Construct specific

Screening (35S-P)

Event specific

Fig. 10.2 Detection strategies for transgenic soya (Roundup Ready soybean). Position of primers for screening (35S-CaMV promoter, nos 5-terminator), construct, and event specific detection methods.

10.3.3 Example of Qualitative Detection

An example of a qualitative approach for detection of transgenic soya is shown in Fig. 10.3. A soybean specific test (nested-PCR for soya lectin gene Le1) is followed by a Roundup Ready soya (RRS)-specific test (nested-PCR, cross-border sequence: CaMV 35S promoter/CTP sequence/EPSPS gene) [27]. A band of 118 base pairs (bp) in the nested soya Le1-gene PCR indicates the presence of soya DNA. Because no amplifiable DNA was detectable in the chocolate sample, the purified lecithin and the soy sauce (lanes 6, 7, and 10), it can also be expected that no DNA from GM soya will be present, which is indicated by amplification of a 169-bp product in the RRS-specific test. All RRS reference samples (lanes 3, 4, 5, and 11) must give this signal. With regard to the two raw lecithin samples (lanes 8 and 9) that were positive for soya DNA, one (lane 9) was also found positive for RRS. The test is qualitative, not quantitative. The detection limit is usually less than 0.1% (w/w) RRS but depends on the food matrix, the average size of the soya DNA, and the presence of PCR inhibitors. 10.3.4 Quantification

Real-time PCR methods for quantification of GM soya or GM maize normally rely on amplification of transgenic specific sequences and their quantification relative to an endogenous (plant-specific) reference gene that gives an estimate of the total amount of target DNA in the sample. Quantification is based on standard curves prepared from reference material. An example of standard curves for real-time

10 Detection Methods for Genetically Modified Crops Soyabean-specific test 1

Roundup Ready soya-specific test

6 7 8 9 10 11 12

11 8 bp

Fig. 10.3 Agarose gel electrophoresis of nested-PCR products obtained from soyaderived raw materials and products for analysis of soya (left) and Roundup Ready soya (right): lanes 1 and 12, molecular weight marker; lane 2, negative control – without DNA; lane 3, positive control – 100% Roundup

6 7 8 9 10 11 12

169 bp

Ready soybeans (RRS); lane 4, soybeans ground and defatted 100% RRS; lane 5, soya protein isolate 100% RRS; lane 6, chocolate; lane 7, purified lecithin; lane 8, raw lecithin, non GMO; lane 9, raw lecithin containing RRS; lane 10, soy sauce; lane 11, raw oil from 100% RRS; bp = base pair.

multiplex PCR for quantification of CaMV 35S-promoter in GM maize is given in Fig. 10.4. The multiplex-PCR method applied is based on quantification of the 35SCaMV promoter and of zein as reference gene for maize on an ABI Prism 7700 sequence detection system (Applied Biosystems, USA). The standard curve was prepared from 1.0% Bt11 maize (CRM standard, Fluka) and approximately 100 ng DNA was used for the first point of the curve (threshold cycle CT of 23 for the zein/ VIC labeled probe and a CT of 29 for the 35S-CaMV/FAM labeled probe) [28]. 10.3.5 Verification

Several methods are used to verify PCR results and they vary in reliability, precision, and cost. Specific cleavage of the amplification products by restriction endonuclease is the simplest method used to identify the PCR products. The presence of the 35S CaMV promoter, for example, is confirmed if the 195 bp fragment is cleaved by the restriction endonuclease XmnI yielding two fragments of 115 and 80 bp [9]. The more time-consuming, but also more specific, transfer of separated PCR products on to membranes (Southern Blot) then hybridization with a DNA probe specific for the target sequence is used in official methods listed in the German Food Act [10]. Alternatively, PCR products may be verified by direct sequencing. This is the most accurate proof of amplified DNA. This technique

211

10.3 Detection Strategies 45 40 35 CT

212

30 25 20 -2.50

-1.50

-0.50

0.50

1.50

2.50

log10

Fig. 10.4 Example of quantification by use of the real-time polymerase chain reaction. Standard curves from 1% Bt11 maize, plot of threshold cycle (CT) values against starting quantity. One curve (circles) represents the CT values (35S-CaMV promoter) plotted against the known quantity of 35S-CaMV

promoter/maize; the other curve (squares) represents the CT values (zein) plotted against the known quantity of Bt11 maize (log format). The amount of 35S-CaMV promoter/zein in unknown samples can be determined by comparison of the CT values with those from the standard curves [28].

is not available in all laboratories, however, and is not the method of choice for routine analysis. Nested PCR assays combine high specificity and sensitivity. Use of two pairs of primers spanning the boundary of two or three genetic elements is regarded as sufficiently specific for a GMO product. In general, the increased sensitivity of nested PCR systems enables low levels of GMOs to be detected in raw materials and finished products. Real-time PCR is the current method of choice for determination of GMOs in food. The accumulation of PCR products can be followed by use of fluorogenic probes. These probes are oligonucleotides which have a reporter and quencher dye attached to either end. In the intact probe the proximity of the quencher greatly reduces the fluorescence emitted from the reporter dye (Förster resonance energy transfer). During PCR the probe anneals to the target sequence which makes the test very specific. As the primer extends along the target sequence it cleaves and fragments the probe, and the reporter dye emits fluorescence because it is no longer in close proximity to the quencher. 10.3.6 Validation

The objective of validation of an analytical PCR method is to demonstrate that the successive procedures of sample extraction, preparation, and analysis yield acceptable accurate, precise, and reproducible results for a given analyte in a specified matrix. The process of validation enables independent use of methods and results which are comparable among each other. For validation of a qualitative analytical test system specificity and/or selectivity, sensitivity (matrix effects and/or inhibition, limit of detection (LOD), accuracy/precision (repeatability, RSDr), intermediate precision, reproducibility (RSDR), and robustness must be established. In addition to these characteristics, limit of quantification (LOQ), accuracy and/or

10 Detection Methods for Genetically Modified Crops

trueness, and linearity and/or working range must be evaluated for a quantitative analytical test system [3]. An increasing number of food control laboratories are adopting PCR as the technology of choice for GMO detection and have validated the methods in-house or by use of ring trials. A limited number of detection methods for GM crops in raw materials or plant-derived foods have been validated by interlaboratory testing [29–38]. A nonexhaustive list of methods tested in ring trials is given in Table 10.4. Any laboratory using such methods is expected to carefully validate every single step of the analytical procedure and participate in performance schemes (e.g. FAPAS), especially for quantitative methods [39]. Tab. 10.4 Selection of methods for GM crop detection validated in interlaboratory studies [29]. An up-dated list of validated methods, including methods reported to Codex Alimentarius, is available from http://biotech.jrc.it [14]. Detection methods submitted under the provision of Art. 47 of Regulation EC 1829/2003 can be found at http://gmo-crl.jrc.it/detectionmethods. htm, and detection methods that have been tested by the Community Reference Laboratory (CRL) in validation studies are listed at http://gmo-crl.jrc.it/statusofdoss.htm. Food source/target

Primers, antibodies (Ab)

CaMV 35S promoter 35S-1/35-S-2 f: 5’-GCTCCTACAAATGCCATCA-3’ r: 5’-GATAGTGGGATTGTGCGTCA-3’ 35S-cf3/35S-cr4 f: 5’-CCACGTCTTCAAAGCAAGTGG-3’ r: 5’-TCCTCTCCAAATGAAATGAACTTCC-3’ Maize Bt11 IVS2-2/PAT-B f: 5’-CTGGGAGGCCAAGGTATCTAAT-3’ r: 5’-GCTGCTGTAGCTGGCCTAATCT-3’ Maize event 176 (Maximizer) Cry03/Cry04 f: 5’-CTCTCGCCGTTCATGTCCGT-3’ r: 5’-GGTCAGGCTCAGGCTGATGT-3’ Cry05/Cry06

f: 5’-CCGCAGCCGATCCAACAATG-3’ r: 5’-GCTGATGTCGATGGGGGTGTAG-3’

Maize Roundup Ready (GA21) GA21 3-5’/GA21 3-5’ f: 5’-GAAGCCTCGGCAACGTCA-3’ r: 5’-ATCCGGTTGGAAAGCGACTT-3’ Maize T25 (Liberty Link) Q T25 1-5’/T25-1-5’/ f: 5’-GCCAGTTAGGCCAGTTACCCA-3’ T25Taq r: 5’-TGAGCGAAACCCTATAAGAACCCT-3’ Maize Mon810 (Yield Gard) VW01/VW03 f: 5’-TCGAAGGACGAAGGACTCTAACG-3’ r: 5’-TCCATCTTTGGGACCACTGTCG-3’ Maize StarLink (CBH 351) CaM03-5’/CBH02-5’ f: 5’-CCTTCGCAAGACCCTTCCTCTATA-3’ r: 5’-GTAGCTGCTGGTGTAGTCCTCGT-3’ Cry9C-5’/35Ster-5’ f: 5’-CCTATAGCTTCCCTTCTTCC-3’ r: 5’-TGCTGTAATAGGGCTGATGA-3’

Size of Refs amplicon

195 bp

EC-JRC, [30]

123 bp

EC-JRC, [31]

189 bp

BgVV, Germany

211 bp

BgVV, Germany, [32] BgVV, Germany, [32]

134 bp

133 bp

NFRI, Japan, [33]

149 bp

NFRI, Japan, [33]

170 bp

BgVV, Germany

170 bp

NIHS, Japan, [34] NIHS, Japan, [34]

171 bp

213

214

10.3 Detection Strategies Tab. 10.4 (continued) Food source/target

Primers, antibodies (Ab)

Protein Cry9C

mAb and polyclonal AB against Bt Cry9C

Maize transgenic event Bt10 JSF3/JSR3 f: 5’-CACACAGGAGATTATTATAGGG-3’ r: 5’-GGGAATAAGGGCGACACGG-3’ Bt11 sweet maize Bt113J-For/ Bt113J- f: 5’-GCGGAACCCCTATTTGTTTA-3’ Rev r: 5’-TCCAAGAATCCCTCCATGAG-3’ Bt113JFT FAM FAM-5’-AAATACATTCAAATATGTATCC(probe) GCTCA-TAMRA-3’ NK603 maize NK603 -F/NK603-R f: 5’-ATGAATGACCTCGAGTAAGCTTGTTAA-3’ r: 5’-AAGAGATAACAGGATCCACTCAAACACT-3’ NK603 (probe) 6-FAM-5’-TGGTACCACGCGACACACTTCCACTC-3’-TAMRA GA21 maize GA21-F/GA21-R f: 5’-CTTATCGTTATGCTATTTGCAACTTTAGA-3’ r: 5’-TGGCTCGCGATCCTCCT-3’ GA21 (probe) 6-FAM-5’CATATACTAACTCATATCTCTTTCTCA ACAGCAGGTGGGT-3’-TAMRA Mon863 Maize Mon863 F/ f: 5’-GTAGGATCGGAAAGCTTGGTAC-3’ Mon863 R r: 5’-TGTTACGGCCTAAATGCTGAACT-3’ Mon863 (probe) 6-FAM-5’-TGAACACCCATCCGAACAAGTAGGGTCA-3’-TAMRA TC1507 Maize MaiY-F1/MaiY-S1 f: 5’-TAGTCTTCGGCCAGAATGG-3’ r: 5’-CTTTGCCAAGATCAAGCG-3’ MaiY-S1 6-FAM-5’-TAACTCAAGGCCCTCACTCCG-3’TAMRA T25 maize MLD143/MDB551 f: 5’-ACAAGCGTGTCGTGCTCCAC-3’ r: 5’-GACATGATACTCCTTCCACCG-3’ TM016 (probe) FAM-5’-TCATTGAGTCGTTCCGCCATTGTCG-3’-TAMRA 59122 Maize DAS-59122-7-rb1f/ f : 5’-GGGATAAGCAAGTAAAAGCGCTC-3’ DAS-59122-7-rb1r r : 5’-CCTTAATTCTCCGCTCATGATCAG-3’

Size of Refs amplicon (AACC), USDA, USA 130

CRL

[38], CRL

108

CRL

112

CRL

102

CRL

10 Detection Methods for Genetically Modified Crops Tab. 10.4 (continued) Food source/target

Primers, antibodies (Ab)

DAS-59122-7-rb1s (probe) NOS-Terminator HA-NOS118-f/HANOS118r NOS-1/NOS-3

6-FAM-5’-TTTAAACTGAAGGCGGGAAACGACAA-3’-TAMRA f: 5’-GCATGACGTTATTTATGAGATGGG-3’ r: 5’-GACACCGCGCGCGATAATTTATCC-3’ f: 5’-GAATCCTGTTGCCGGTCTTG-3’ r: 5’-TTATCCTAGTTTGCGCGCTA-3’

Papaya 55-1, 66-1 CaM3-5’/GUSn-5’

f: 5’-CCTTCGCAAGACCCTTCCTCTATA-3’ r: 5’-TCGTTAAAACTGCCTGGCAC-3’ NosC-5’/CaMVN-5’ f: 5’-TTACGGCGAGTTCTGTTAGG-3’ r: 5’-CATGTGCCTGAGAAATAGGC-3’ Potato NewLeaf Plus p-FMV02-5’/ f: 5’-AAATAACGTGGAAAAGAGCTGTCCTPLRV01-5’ GA-3’ r: 5’-AAAAGAGCGGCATATGCGGTAAATCTG-3’ PLRV-rep1-5’/PLRV- f: 5’-CTTCTTTCACGGAGTTCCAG-3’ rep1-5’ r: 5’-TCGTCATTAAACTTGACGAC-3’ Potato New Leaf Y p-FMV05-5’/PVY02- f: 5’-AAAAGAGCTGTCCTGACAGC-3’ 5’ r: 5’-TCCTCCTGCATCAATTGTGT-3’ PVY01-5’/PVY01-5’ f: 5’-GAATCAAGGCTATCACGTCC-3’ r: 5’-CATCCGCACTGCCTCATACC-3’ Soya Roundup Ready 35S-af2/Petu-r1 f: 5’-TGATGTGATATCTCCACTGACG-3’ r: 5’-TGTATCCCTTGAGCCATGTTGT-3’ Q-RRS1-F/RR1-R/ Probe

f: 5’-CATTTGGAGAGGACACGCTGA-3’ r: 5’-GACCCATGTTGTTAATTTGTGCC-3’

Protein EPSPS

mAb and polyclonal Ab against CP4 EPSPS

Size of Refs amplicon

118 bp

EC-JRC, [31]

180 bp

EC-JRC, [30]

250 bp

NIHS, Japan, [35] NIHS, Japan, [35]

207 bp

234 bp

NIHS, Japan, [36]

172 bp

NIHS, Japan, [36]

225 bp

NIHS, Japan

161 bp

NIHS, Japan

171 bp

BgVV, Germany

74 bp

BgVV, Germany, GenScan Europe AG EC-JRC, [35]

f – forward primer, r – reverse primer, mAB – monoclonal antibody EC-JRC – European Commission, Joint Research Center BgVV – Federal Institute for Health Protection of Consumers and Veterinary Medicine, Germany NIHS – National Institute of Health Sciences, Japan NFRI – National Food Research Institute, Japan USDA – United States Department of Agriculture, USA AACC – American Association of Cereal Chemists

215

216

10.4 Outlook Conclusions

10.4 Outlook, Conclusions

Although one could question the scientific basis of parts of the current and pending EU GMO regulations and whether they will achieve the desired objective of restoring consumer confidence, they are reality in the European Union. Industry must therefore cope with their requirements and find solutions which are both acceptable to consumers and economically feasible. Thresholds and IP play a very important role in finding these solutions. The current threshold has initiated substantial activity along the chain and there are chances that newly proposed regulations will not reduce these efforts. In an average industrial setting incoming raw materials will be tested for the presence of (known) GM varieties. Immunoassays can be used for primary materials whereas for each subsequent point of analysis, i.e. after transport, processing steps, etc., PCR methods will be used. ELISA-based techniques were initially used as the method of analysis for determination of GM crops in food ingredients (e.g. soya flour in flour) but these were found to be less appropriate for determination of GMOs in compound foods. If raw materials are analyzed, protein-based methods could be an alternative to DNA-based PCR methods. The latter will be applied for both qualitative and quantitative purposes. Although real-time PCR is the method of choice for the quantification of DNA, it is difficult to measure low levels of GM material in processed food. Although there are still question marks about reliability of the different methods and about the availability of probes for those GMOs that can reasonably be expected to be present in a given lot, the overall experience is that for practical purposes the methods are workable. New GM traits of a variety of crops are in development and will enter the market sooner or later, and existing commercialized GM products will disappear. Continuous monitoring of the level of GM materials and identification of variety genotypes will therefore be prerequisites for verification of non-GMO status in the supply chain, and validated methods are required. The question that remains is whether the effort devoted to this issue is justified in relation to other issues the agro-food chain is facing.

10 Detection Methods for Genetically Modified Crops

References 1 E. Anklam and D.A. Neumann, J. AOAC Int., 2002, 85, 754–756. 2 G. Van den Eede, S. Kay, E. Anklam, H. Schimmel, J. AOAC Int., 2002, 85, 757–761. 3 E. Anklam, F. Gadani, P. Heinze, H. Pijnenburg, and G. Van den Eede, Eur. Food Res. Technol. 2002, 214, 3–26. 4 R. Meyer, Food Control, 1999, 10, 391–399. 5 ISO 13890: Cereals, pulses and milled products – sampling of static batches. 6 http://www.gipsa.usda.gov/biotech/sampling_grains_for_biotechnolog.htm 7 Detection of genetically modified organisms and derived products – sampling. CEN/TC 275/WG11. ISO/DIS 21568:2005 8 Commission Recommendation 2004/787/EC of 4 October 2004 on technical guidance for sampling and detection of genetically modified organisms and material produced from genetically modified organisms as or in products in the context of Regulation (EC) No 1830/2003, Official Journal of the European Union L348 from 24.11.2004, p. 18. 9 Swiss Food Manual (2002), chapter 52B, (CD-ROM available from BBL-EDMZ, CH-3030 Bern, Ed. Bundesamt für Gesundheit, Facheinheit Lebensmittel und Gebrauchsgegenstände, Bern. E-mail: [emailprotected]. 10 Official Collection of Test Methods (1998) Detection of a genetic modification of soybeans by amplification of the modified DNA sequence by means of the polymerase chain reaction (PCR) and hybridisation of the PCR product with a DNA probe. German Federal Foodstuffs Act – Food Analysis, article 35, L 23.01.22-1. Beuth, Berlin Köln. 11 K. Meyer, C. Rosa, C. Hischenhuber, R. Meyer, J. AOAC Int., 2001, 84, 89–99. 12 A. Wurz, H. Rüggeberg, P. Brodmann, H.U. Waiblinger, K. Pietsch, Dt. Lebensm. Rundsch., 1998, 94, 159–161. 13 AGBIOS, Agriculture and Biotechnology Strategies Inc., Canada. (http://www. agbios.com). 14 DMIF-GEN (1999) Development of methods to identify foods produced by means of genetic engineering. EU-Project SMT4-

18 19

20 21

23 24 25 26

CT96-2072. DMIF-GEN Final Report, 15 December 1999. DMIF-GEN database (http://biotech.jrc.it/documents/GMOmethods-Report-PCR.pdf). R. Meyer, F.Chardonnens, P. Hübner, J. Lüthy, Z. Lebensm. Unters. Forsch. 1996, 203, 339–344. E. Studer, C. Rhyner, J. Lüthy, P. Hübner, Mitt. Gebiete Lebensm. Hyg. 1997, 88, 515–524. B. Ehlers, E. Strauch, M. Goltz, D. Kubsch, H. Wagner, H. Maidhof, B. Bendiek, B. Appel, H.-J. Buhk, Bundesgesundheitsbl., 1997, 4, 118–121. C. Wolf, P. Hübner, J. Lüthy, Mitt. Gebiete Lebensm. Hyg. 2001, 92, 159–167. M. Hernández, A. Río, T. Esteve, S. Prat, M. Pla, J. Agric. Food Chem., 2001, 49, 3622–3627. C. Wolf and J. Lüthy, Mitt. Lebensm. Hyg. 2000, 91, 352–355. C. Wolf, M. Scherzinger, A. Wurz, U. Pauli, P. Hübner, J. Lüthy, Eur. Food Res. Technol., 2000, 201, 367–372. M. Allmann, U. Candrian, J. Lüthy, Z. Lebensm. Unters. Forsch. 1993, 196, 248–251 R. Meyer, Ch. Höfelein, J. Lüthy, U. Candrian, J. AOAC Int., 1995, 78, 1542–1551. P. Taberlet, L. Gielly, G. Pautou, J. Bouvet, Plant Mol. Biol. 1991, 17, 1105–1109. G. van Duijn, Chemisch Magazine, 1997, 411–413. M. Hernández, M.-N. Duplan, G. Berthier, M. Vaitilingom, W. Hauser, R. Freyer, M. Pla and Y. Bertheau. J. Agric. Food Chem. 2004, 52, 4632–4637. R. Meyer and E. Jaccaud (1997) Detection of genetically modified soya in processed food products; development and validation of a PCR assay for the specific detection of Glyphosate-Tolerant Soybeans. In: R. Amado, R. Battaglia (eds) Proceedings 9th European Conference on Food Chemistry. Authenticity and adulteration of food – the analytical approach, vol. 1. Interlaken, Switzerland 24–26 September 1997, pp 23–28. M. Höhne, C. Rosa Santisi, R. Meyer, Eur Food Res. Technol., 2002, 215, 59–64.

217

218

References 29 Codex Alimentarius Commission. Codex Committee on Methods of Analysis and Sampling, 24th Session, Budapest, Hungary, 18–22 November 2002. (ftp://ftp.fao.org/codex/ccmas24/ ma02_08e.pdf) 30 M. Lipp, E. Anklam, P. Brodmann, K. Pietsch, J. Pauwels, Food Control 10, 1999, 379–383. 31 M. Lipp, A. Bluth, F. Eyquem, L. Kruse, H. Schimmel, G. Van den Eede, E. Anklam, 2001, Eur Food Res. Technol, 212, 497–504. 32 C. Hupfer, H. Hotzel, K. Sachse, K.-H. Engel, 1998, Z. Lebensm. Unters. Forsch. 206, 203–207. 33 Y. Shindo, H. Kuribara, T. Matsuoka, S. Futo, C. Sawada, J. Shono, H. Akiyama, Y. Goda, M. Toyoda, A. Hino, 2002, J. AOAC Int., 85, 1119–1126

34 T. Matsuoka, H. Kuribara, S. Suefuji, H. Miura, Y. Kusakabe, H. Akiyama, Y. Goda, K. Isshiki, M. Toyoda, A. Hino, 2001, J. Food Hyg. Doc. Japan, 42, 197–201. 35 Y. Goda, T. Asano, M. Shibuya, A. Hino, M. Toyoda, 2001, J. Food Hyg. Japan 42, 231–236. 36 H. Akiyama, K. Sugimoto, M. Matsumoto, K. Isuzugawa, M. Shibuya, Y. Goda, M. Toyado, J. Food Hyg. Japan, 2002, 43, 24–29. 37 M. Lipp, E. Anklam, J. AOAC Int., 2000, 83, 919–927. 38 S.B. Rønning, M. Vaïtilingom, K. G. Berdal and A. Holst-Jensen. Eur. Food Res Technol 2003, 216, 347–354. 39 P. Hübner, H.-U. Waiblinger, K. Pietsch, P. Brodmann, J. AOAC Int., 2001, 84, 1855–1864.

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods Karl-Heinz Engel, Francisco Moreano, and Alexandra Ehlert

11.1 Introduction

The advantages and potential risks arising from the application of genetic engineering in the production of food and feed have been the subject of many controversial discussions [1]. Public skepticism has resulted in the implementation of regulatory frameworks that require monitoring and labeling of genetically modified organisms (GMO) and their derivatives in the food chain, and this has initiated much research activity to develop the necessary detection techniques [2–5]. In the European Union, legal requirements for labeling of GMO-derived foods were initially provided by the so-called Novel Foods Regulation [6] and its amendments [7–9]. Labeling was triggered by the detection of either protein or DNA from the GMO. This initiated the first wave of analytical methods mainly focusing on the detection of DNA from GMO by qualitative PCR. New regulations containing harmonized provisions for risk assessment and authorization of GMO, and for traceability, labeling, and post-marketing surveillance of the use of GMO in the food and feed chain, have recently been implemented [10, 11]. Regulation (EC) No 1830/2003 [11] defined the establishment of a traceability system enabling documentation and monitoring of the flow of GMO and GMO-derived products at all stages along the food and feed chain. According to Regulation (EC) No 65/2004 [12] information on traceability includes a unique code identifier for the respective transformation event. With this novel strategy, labeling requirements have been extended to highly processed products and no longer depend on a positive result from testing for recombinant DNA or protein. It is, however, acknowledged that the possibility of adventitious contamination with traces of GMO-derived material cannot be excluded. The current regulations therefore define thresholds for adventitious or technically unavoidable traces of GMO-derived material in food and feed products. For example, labeling is not required if the proportion of material containing an authorized GMO is not higher than 0.9% (considered individually for each ingredient). Monitoring compliance with these legal provisions requires the availability of appropriate methods for detec-

220

11.2 Challenges Specific to the Detection of GMO in Composite and Processed Foods

tion and quantification of GMO in raw materials, in processed products, and in composite foods. This chapter reviews current strategies for detection of GMO in foods, focusing especially on issues related to composite and processed foods. The suitability of protein and DNA-based methods for detection and quantitation of GMO is discussed, taking into account that commonly used food technological processes may result in significant changes of these target compounds.

11.2 Challenges Specific to the Detection of GMO in Composite and Processed Foods

Mechanical stress, heat treatment, pH variations, enzyme treatment, and fermentation are common conditions in food processing which may result in significant degradation of proteins and nucleic acids. In food ingredients and in foods made from them, the presence of analytes suitable for GMO detection will clearly depend on the degree of processing to which the raw materials have been exposed. In addition to degradation, intentional or unintentional removal of DNA or protein in the course of food processing is also important. Aspects of food manufacture which might critically affect the potential to detect the products of genetic engineering in composite and processed foods are outlined in Fig. 11.1. Raw materials (e.g. crops) may be subject to a spectrum of processes which differ in the degree of treatment, ranging from simple mechanical procedures such as milling to complex sequences of chemical reactions, for example the refining of edible plant oils. The products obtained may be used as foods or serve as ingredients for the production of composite foods. The formulation of several food ingredients to create composite foods will result in additional challenges to GMO analysis, because it is highly likely that the extent of degradation of the target molecules will not be the same in each ingredient. Considering that each ingredient has a characteristic matrix and composition, it is highly probable that analytes incorporated in different matrices will not be equally accessible to analysis. Subsequent processing of composite foods may lead to chemical and structural changes and interactions between ingredients used for food preparation, again resulting in increasing analyte degradation. The processes involved in the production of such complex foods can be limited to rather simple steps, for example mixing, but they may also involve severe thermal treatment which induces chemical changes, for example baking. It is unclear whether degradation will progress equally in every ingredient, or if ingredient matrices may have an effect on degradation rates. Methods for analysis of GMO in foods must cope with the challenges set by the complexity of analyte degradation and additional problems related to composite foods. All steps of GMO analysis, including detection, identification, and quantification [4], are affected by these technological factors.

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

raw material

processing degree of treatment e.g. milling fraction

GMO Analysis

e.g. highly refined oil

ingredients formulation

• detection • identification • quantification

processing degree of treatment e.g. emulsion

e.g. baking produkt

product

Fig. 11.1 Challenges specific to GMO analysis during food processing.

11.3 Degradation of Proteins and DNA

Proteins and DNA are subject to degradation as a result of the physical, enzymatic, and chemical treatment that may occur during food processing. 11.3.1 Proteins

Denaturation of proteins is initiated by reversible or irreversible changes of the native conformation (secondary, tertiary, or quaternary structure). These changes may result from breakage of stabilizing disulfide bonds or hydrogen bonds, neutralization of ionic groups, or hydrophilic and/or hydrophobic interactions. Denaturation may result from the application of shear forces, or it can be initiated by changes in temperature or pH, by enlargement of interface areas, or by addition of organic solvents, salts, or detergents. Reversible denaturation usually occurs when the unfolded molecule is stabilized by interactions with the denaturing agent, for example an organic solvent. Removal of the denaturing agent consequently enables recovery of native protein configuration. Irreversible denaturation occurs

221

222

11.3 Degradation of Proteins and DNA

when unfolded proteins are stabilized by formation of intra or intermolecular covalent bonds, usually disulfide bonds between free thiol groups. Food manufacture, maturation, or spoilage processes involve several enzymatic reactions, and this leads to major changes in the structural properties of proteins. In addition to functional group transfer reactions and redox reactions, the protease-catalyzed cleavage of peptide bonds is seen as the most important reaction contributing to protein degradation [13]. Hydrolytic fragmentation of proteins occurs in acidic media, especially when combined with heat treatment. Food processing may induce further chemical modification of native proteins, depending on the presence of available functional groups (intra and intermolecular cross-linking via disulfide, isopeptide, and ester bonds), on the composition of the food (presence of reducing sugars or free oxygen), and on the process conditions used (e.g. temperature, pH, or high pressure). Proteins have linear and conformational epitopes that may be recognized by specific antibodies. Immunoassays have been used to follow structural changes of proteins during food processing as result of mechanical and thermal treatment during extrusion, cooking, roasting, or autoclaving [14–18]. 11.3.2 DNA

Although the chemical stability of DNA, as a macromolecule, is relatively high, a broad spectrum of chemical and enzymatic reactions can result in DNA modification and/or degradation [19]. Food manufacture involving mechanical processes, fermentation steps, or heat treatment may contribute to such reactions. DNA fragmentation may be initiated by application of shear forces [20]. The disruption of plant material results in the destruction of cell compartments, which in turn brings formerly separated enzymes and substrates into contact. As a result, DNA extracted from plant tissues is susceptible to digestion by endogenous nucleases [21]. DNA preparation involves the use of proteases or strong protein denaturing agents to eliminate the activity of nucleases and enable the isolation of high-molecular-weight DNA. If no denaturants are used, DNA may be degraded to fragments of less than 500 base pairs (bp) within an hour [22]. Klein et al. [23] followed the fate of DNA during the industrial extraction of sugar from sugar beet. When purified nucleic acid was added to raw juice (one of the intermediate products) at 70 °C, rapid degradation of DNA was observed, which indicated the presence of nucleases in the plant material. Nucleic acids undergo spontaneous nonenzymatic hydrolysis in solution, with RNA being more vulnerable than DNA. At low pH, depurination of the N-glycosidic link between purine bases and deoxyribose in the nucleic acid backbone is the first step in the degradation of DNA; this is followed by hydrolysis of adjacent 3,5phosphodiester linkages at the depurinated site. This acid-catalyzed reaction results in measurable shortening of DNA strands and is accelerated by simultaneous heat treatment, resulting in a random cleavage of DNA molecules [24, 25].

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods Fig. 11.2 DNA fragmentation during heating.

Several studies have described the effects of food processing on the fragmentation of DNA. For example, the mean fragment length of DNA extracted from heattreated pork was reduced from 1.1 kb to 0.3 kb [26]. Similar effects were observed in DNA from processed tomato products [27]. Kingombe et al. [28] demonstrated that proteins and DNA are severely degraded during treatment of meat meal at 133 °C and 3 bar for 20 min. The shift of the mean fragment length of DNA extracted from maize flour subjected to heat treatment at 95 °C is shown in Fig. 11.2 [29]. Quantitative data describing the recovery of DNA sequences in material treated under such conditions are presented in Section 11.4.2.2. Ensiling is another example of a process which creates a harsh environment for plant DNA as a result of a combination of reactions. Chopping of plant tissue results in disruption of cell walls and membranes, release of DNA, and, eventually, degradation by endogenous nucleases of the plant and/or exogenous nucleases of the microflora. In addition, reduction of the pH as a result of lactic acid fermentation accelerates DNA degradation. These reactions were reflected in the different amounts of DNA in extracts obtained from nonensiled and ensiled Bt maize [30].

223

224

11.4 Analytical Methods

11.4 Analytical Methods 11.4.1 Protein-based Methods

For detection of GMO in raw materials, a variety of methods based on the recognition of recombinant proteins have been developed. The most common test formats are enzyme-linked immunosorbent assays (ELISA) and immunochromatographic (lateral flow) strip tests [31]. These methods are available for the proteins expressed in the most important GMO, including insect-resistant maize, potatoes, and cotton or herbicide-resistant maize, potatoes, cotton, soybean, and canola [32–35]. The stability of recombinant CryIA(b) protein during ensiling of Bt maize has been studied [36]. The disruption of the maize tissue, the reduction of pH because of lactic acid fermentation, and the action of plant and microbial proteases result in degradation of the recombinant protein during the ensiling process. After four months of ensilage, no CryIA(b) protein could be detected by ELISA using immunoaffinity-purified polyclonal rabbit and protein G-purified goat antibodies specific for the protein. Using herbicide-tolerant soybeans as an example, the importance of selecting appropriate antibody reagents for the form of protein to be detected in the sample has been demonstrated [31]. One ELISA could be used to recognize the CP4 EPSPS protein in soybeans and defatted soybean flakes, but not in soybean toasted meal. Hence, a second test was necessary which involved antibodies that reacted specifically with the denatured protein present in the heat-treated material. The limitation of an immunoassay to detection of either the native proteins or the denatured proteins is a major drawback to the application of protein-based methods for the analysis of processed foods. As protein denaturation advances continuously during the course of processing, the quantitative character of immunoassays would be lost unless innumerable quantitation standards were developed to describe correctly the amounts of targeted proteins at every stage of processing. With regard to composite foods, it must be considered that immunoassays are not capable of discriminating between similar recombinant proteins expressed by different transgenic crops. Quantitative analysis of food samples containing different ingredients from recombinant crops would require the development of eventspecific assays enabling differentiation of all recombinant proteins. 11.4.2 DNA-based Methods

Methods for the detection of specific DNA sequences are based on polymerase chain reaction (PCR) techniques. The principles of this method have been described in detail elsewhere [37]. Aspects essential for qualitative and quantitative PCR in composite and processed foods are outlined in the following paragraphs.

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

11.4.2.1 Qualitative PCR Extraction of DNA and inhibition of PCR DNA-extraction procedures and commercially available kits currently used for routine analysis have been designed to guarantee high DNA quality and effective removal of inhibiting compounds in processed foods or tissue samples [38–41]. The performance of several widely applied DNA extraction methods in respect of DNA quality and yield has been compared [42]. Extraction methods have been developed and/or modified to recover amplifiable DNA from highly processed products. Strategies to facilitate the extraction of DNA from products such as lecithin have been reported [43]. Commercially available kits based on use of DNA-binding resins deliver low DNA yields but high DNA quality, enabling detection of DNA sequences in even highly processed food additives such as lecithin [42]. Foods are complex systems which contain a broad range of compounds other than DNA; these may inhibit PCR reactions and thus lead to false negative results. Inhibiting compounds may be present in tissues of analytical samples (e.g. polysaccharides, lipids, and polyphenols) or may be chemicals applied during DNA extraction [44–51]. Routine use of hom*ologous or heterologous internal positive controls in PCR reactions is a simple but powerful means of overcoming uncertainties, for example false negative results [52]. Sensitivity of PCR Amplification efficiency in PCR is reduced by factors such as inhibiting agents, reagent limitation, and increasing viscosity of the mixture. In theory, qualitative PCR analysis may detect even a single DNA sequence in a reaction vessel. Routine testing has demonstrated that detection limits ranged between one and ten copies of the targeted DNA fragment [53]. The sensitivity of PCR systems depends on several factors, including the number of run cycles, the position of the reaction vessel in the thermocycler, the affinity of the primers for the targeted sequence, amplicon length, the presence of inhibiting compounds, the composition of reaction mixtures, and DNA quantity and quality. It is, therefore, difficult to make a general statement about the sensitivity of PCR reactions, and these must be validated on a case-by-case basis [54]. Specificity of PCR Potentially, methods for DNA analysis can be directed at a variety of targets for detection of GMO; these include the transgene itself, regulatory and marker gene sequences, and overlapping and/or border region sequences [5, 55]. DNA target sequences must be chosen carefully to guarantee high specificity in PCR systems. Positive detection of the genetic elements usually used for the transformation of crops, for example the cauliflower mosaic virus (CaMV) 35S promoter or the NOS terminator from Agrobacterium tumefaciens, are strongly indicative of the presence of GMO-derived DNA in the sample. Positive signals may, however, also be obtained as result of contamination of analytical samples with bacteria or viruses if the primer sequences chosen are not sufficiently specific [56, 57].

225

226

11.4 Analytical Methods

In contrast, unambiguous results are obtained if the chosen primers cover overlapping areas that comprise regulatory sequences and the transgene; that is, sequences that do not occur naturally [58]. The successful use of this strategy has been demonstrated for the Flavr Savr tomato, glyphosate-resistant crops (Roundup Ready cotton and soybeans), LibertyLink and Seed Link rapeseed lines, and several transgene maize lines [59–63]. Additional attention must also be paid to the fact that similar genetic constructs are being used in different crops. An overview of maize events containing the commonly used insect resistance (cryIA(b) gene) and/or herbicide tolerance (EPSPS gene) traits is provided in Table 11.1. Even more specific detection is achieved when the targets consist of sequences covering the integration site between the plant genome and the transgene; this results in event-specific methods suitable for the detection of single transgenic lines. At this level of specificity it is possible to discriminate between authorized and nonauthorized GMO containing similar transgenic constructs. Examples of eventspecific methods used for quantitative PCR are given in Section 11.4.2.2. DNA degradation The effects of using highly fragmented DNA as a template for PCR have been elucidated [64]. DNA fragmentation severely reduces the efficiency of PCR. In accordance with these findings, the effect of the size of the targeted sequence on the detection of insect-resistant Bt 176 maize in heat-treated products has been described [62]. The probability of detecting the GMO decreased rapidly during the course of heat treatment when targeting the entire 1914 bp sequence of the synthetic cryIA(b) gene. On the other hand, a shorter target sequence (211 bp), covering part of the CDPK promoter and the cryIA(b) gene, was detectable even after heating for 105 min. Other investigations addressed the effects on the degradation of DNA and, consequently, on the traceability of target sequences of fermentation and/or thermal processes, for example ensiling of transgenic maize or distillation of ethanol from fermented transgenic invertase potato (B33-INV) mash [30, 65]. The detectability of Bt-specific genetic modification in ensiled maize material was found to depend on the length of the genomic target region to be amplified. By amplifying a Bt maize-specific DNA sequence of 211 bp, the genetic modification was detected up to seven months after ensilage. Detection of the transgene via a 1914 bp amplicon was, in contrast, only possible for up to five days of ensilage. A 190 bp sequence of the patatin gene and a 839 bp sequence of the hygromicin phosphotransferase gene were used as targets to follow the detection of DNA in the course of the distillation process for converting potatoes into ethanol [65]. When the 190-bp amplicon was used, potato DNA could be detected after all steps; positive results were obtained even in the splent. Detection of the 839 bp sequence was limited by the distillation step, however. Klein et al. [23] followed the elimination of nucleic acids during sugar manufacture. Intermediates and end products were analyzed for the presence of DNA, by PCR, using the ADP-glucose pyrophosphorylase (AGPase) gene as a target for sugar beet DNA, and the genes for the beet necrotic yellow vein virus coat protein

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods Tab. 11.1 Maize events containing the commonly used transgenic constructs cryIA(b) gene and/or EPSPS gene. Event

Company

Description

176

Syngenta Seeds

Insect-resistant maize produced by inserting the cry1Ab gene from Bacillus thuringiensis subsp. kurstaki. The genetic modification affords resistance to attack by the European corn borer (ECB)

BT11

Syngenta Seeds

Insect-resistant and herbicide-tolerant maize produced by inserting the cry1Ab gene from Bacillus thuringiensis subsp. kurstaki, and the phosphinothricin N-acetyltransferase (PAT) encoding gene from S. viridochromogenes

MON80100

Monsanto

Insect-resistant maize produced by inserting the cry1Ab gene from Bacillus thuringiensis subsp. kurstaki. This genetic modification affords resistance to attack by the European corn borer (ECB)

MON802

Monsanto

Insect-resistant and glyphosate herbicide-tolerant maize produced by inserting the genes encoding the Cry1Ab protein from Bacillus thuringiensis and the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) from A. tumefaciens strain CP4

MON809

Pioneer Hi-Bred

Resistance to the European corn borer (Ostrinia nubilalis) by introduction of a synthetic cry1Ab gene. Glyphosate resistance by introduction of the bacterial version of a plant enzyme, 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS)

MON810

Monsanto

Insect-resistant maize produced by inserting a truncated form of the cry1Ab gene from Bacillus thuringiensis subsp. kurstaki HD-1. This genetic modification affords resistance to attack by the European corn borer (ECB)

GA21

Monsanto

Introduction, by particle bombardment, of a modified 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS), an enzyme involved in the shikimate biochemical pathway for production of aromatic amino acids

MON832

Monsanto

Introduction, by particle bombardment, of glyphosate oxidase (GOX) and a modified 5-enolpyruvyl shikimate3-phosphate synthase (EPSPS), an enzyme involved in the shikimate biochemical pathway for production of aromatic amino acids

227

228

11.4 Analytical Methods Tab. 11.1 (continued) Event

Company

Description

NK603

Monsanto

MON88017

Monsanto

Corn rootworm-resistant maize produced by inserting the cry3Bb1 gene from Bacillus thuringiensis subspecies kumamotoensis strain EG4691. Glyphosate tolerance derived by inserting a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene from Agrobacterium tumefaciens strain CP4

(cp21) and neomycin phosphotransferase (aphA) as specific targets for the virus-resistant transgenic beet DNA. Southern blot hybridization of the targeted sequences delivered positive signals in PCR samples from raw juice only, and not in those from carbonation sludge I, carbonation sludge II, thin juice, thick juice, or white sugar from transgenic beet. These results were indicative of a severe degradation of nucleic acids already in the first steps of processing. This was verified by adding pUC18 DNA to fresh raw juice samples and incubating the mixtures for different periods of time. The resulting DNA degradation was ascribed to the enzymatic activity of sugar beet endogenous nucleases. Further disappearance of DNA was explained by its irreversible adsorption on the sludge, precipitation, hydrolysis because of the high temperatures used in the carbonation and evaporation steps, and as result of exclusion of DNA in the crystallization step. Hellebrand et al. [66] investigated the presence of rapeseed DNA in cold pressed and refined oils by using a nested PCR system. The starting point was the assumption that the thermal stability of DNA under alkaline conditions should be sufficient to partially preserve DNA throughout the processing, and that the filtration steps (as used in the oil industry) are not capable of retaining DNA molecules. Amplifiable DNA could be isolated from cold pressed oil samples. PCR analysis of extracts from refined oil samples delivered non-specific signals which could not be unequivocally identified, however. Again, the importance of choosing short target fragments for successful detection was emphasized. The limitations of PCR-based detection of genetically modified soya in the course of bread production have been studied by different approaches which revealed that analytical success was very dependent on the individual processing conditions. Straub et al. [67] employed an official method according to §35 of the German Food Law, which had previously been validated in an interlaboratory study. It was shown that high-molecular-weight DNA was only present in baking aids and flour samples, whereas DNA isolated from dough and bread samples had been partially degraded such that average fragment sizes were <500 bp and <300 bp, respectively.

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

Although the amount of genetically modified soya in the baking aid was diluted to 0.4% of the dry matter in the end product, positive detection of the targeted sequences was achieved at every stage of processing. Moser et al. [68] assessed how different bread and pastry baking conditions affected DNA degradation and, as a consequence, the traceability of target sequences. Genetically modified maize (used in whole-grain bread and pastry) and soybean (used in toast bread) were added at concentrations of 0.5% and 0.3%, respectively. The maize-specific sequence of the invertase gene was successfully detected, even in the end products, whereas no positive results were obtained for the transgenic target sequence at the final stage of processing of the whole-grain bread and pastry. This indicated that the combination of either acidic media or mechanical stress in the extrusion stages with exposure to thermal treatment completely prevented detection of transgenic DNA at the concentration given. In contrast, transgenic and isogenic soya DNA was detected at all stages of manufacture. The reduced overall stress during production of toast bread did not, apparently, result in complete degradation of the targeted sequences. Straub et al. [69] investigated the effect of storage on the fate of DNA from recombinant starter cultures in fermented, heat-treated sausages. Free recombinant DNA of the starter culture obtained from the meat matrix was shown to represent only a minute part of the total recombinant DNA content recovered after lytic treatment of the cell walls. Worst-case studies showed that minute amounts of free recombinant DNA were protected by the meat matrix against the activity of DNase and could be detected even after storage for more than nine weeks. The other portion of recombinant DNA remained entrapped in the dead cells and so was even better protected against enzyme activity. Again, DNA deterioration was most clearly observed when long (1322 bp) rather than short (166 bp) target sequences were chosen. Degradation of DNA because of stress during food processing has been the subject of several studies examining the effect of fermentation, heating, and other forms of processing on the DNA-based detection of GMO. These approaches have shown the suitability of PCR technology for detection of target DNA sequences from GMO or pathogenic microorganisms, even at advanced stages of processing [30, 62, 65, 70–72]. High sensitivity can be achieved if appropriate DNA extraction methods capable of eliminating potential inhibitors are used. Internal positive controls are required to rule out false-negative results. The specificity of GMO detection can be improved by use of appropriate primer pairs. Event-specific discrimination between GMO with similar transgenic constructs is achievable. Degradation of DNA in the course of food processing has an adverse effect on detection efficiency, especially when long target sequences are to be detected. Target sequences ≤100 bp have been shown to withstand harsh manufacturing processes.

229

230

11.4 Analytical Methods

11.4.2.2 Quantitative PCR Standard PCR endpoint analysis, as used for the qualitative detection of DNA sequences, cannot be used for quantification, because of variable amplification efficiency between different PCR reactions and within the process of a PCR reaction itself. Currently available methods for quantitation of DNA sequences are based either on competitive PCR or on real-time PCR techniques. Irrespective of the technique used, determination of the ingredient-related GMO content of composite and processed foods requires the simultaneous assessment of DNA sequences specific for the genetic modification and for an endogenous reference gene. This strategy is based on the assumption that the breakdown of both target sequences occurs simultaneously. This type of relative quantitation is therefore regarded as reflecting the proportion of GMO during all stages of processing [73]. Sensitivity of quantitative PCR Detection limits of quantitative PCR, as a percentage of GM material, depend on the amount of amplifiable genome copies from the plant species available in the sample. For example, if 104 copies of plant DNA were extracted from the food sample, the detection limit would be between 0.01% and 0.1%. These values reflect the theoretical best case (when one single target sequence is detected) and the worst case (when ten copies of the target sequence are needed to yield a positive signal). The limit of quantitation using TaqMan technology has been empirically set at ten copies of the targeted DNA sequence, taking into account that it is almost impossible to obtain reproducible data in triplicate or quadruplicate at lower copy levels. This means that if, again, 104 copies of the plant genome were extracted from the food sample, the quantitation limit would not enable differentiation between GMO contents below 0.1% (ten molecules of GM DNA in 104 molecules of species DNA) [45]. Three types of detection and quantification limits have been distinguished: 1. the absolute limits, i.e. the lowest number of copies required at the first PCR cycle to achieve a probability of at least 95% of detecting and quantifying correctly; 2. the relative limits, i.e. the lowest relative percentage of GM material that can be detected and quantified under optimum conditions; and 3. the practical limits, i.e. limits taking into consideration factors such as the actual content of the DNA sample and the absolute limits of the method [74]. Both the LOD and LOQ of the method and the practical LOD and LOQ for the test sample should be reported together with the results [55, 74]. Validation of quantitative assays for GMO in foods cannot be limited to unprocessed reference materials. Validation procedures must demonstrate that neither food composition nor processing will result in distortion of results from quantification. Specificity of quantitative PCR When developing methods for quantitative detection of GMO in composite foods, special attention must be paid to the fact that similar genetic constructs are being used in different crops. Suitable target genes

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

must therefore be chosen to enable analysts to assign the detected DNA target sequence to the respective genetically modified crop. This objective can be achieved by implementation of event-specific detection systems [75]. Event-specific methods have been described for detection of several maize lines (Bt 11 [76–78], Bt 176 [77], T 25 [79], GA21 [77], MON 863 [80], MON 810 [81–83], NK603 [83–85]), canola event GT73/RT73 [77], cotton MON 531 and MON 1445 [86], and Roundup Ready soya [74, 87–89].

11.4.2.3 Competitive PCR Quantitative competitive PCR is based on the co-amplification of the target DNA sequence and an exogenous standard (competitor) which is spiked into each sample at known concentration [90–94]. Both target DNA and competitor have identical primer binding sites and similar internal sequences and are of similar length. Throughout the PCR reaction, amplification of the target and competitor sequences underlie identical reaction conditions and compete for the same limiting reagents, for example primers. If amplification kinetics are equivalent for both the target and competitor sequences the ratio of the molar amounts of both PCR products equals the ratio of the amounts of target DNA and competitor in the sample before amplification. Quantitation is most accurate at the point of equivalence, i.e. when the molar ratio of target to internal standard sequences in the reaction probe is equal to unity. Sample analysis by competitive PCR requires the preparation of several samples, each containing a constant template DNA concentration but increasing competitor concentrations to enable accurate calculation of the amount of competitor at the point of equivalence. Ratios of signal intensities of competitor and target amplicons measured after gel electrophoresis are plotted logarithmically against amounts of competitor initially used in the sample. The point of equivalence is determined by the intersection of the linear regression curve and the abscissa [95]. On this theoretical basis, several methods have been developed for quantitation of DNA sequences occurring in transgenic crops commonly used for the production of foods and food ingredients [78, 96–100]. Studer el al. [100] described the construction of internal standards for quantitation of Roundup Ready soybean and for quantitation of Bt 176 maize in food samples. The systems were calibrated with recombinant DNA mixtures and tested with certified, commercially available standards; reproducible results and good linearity were obtained within the range of operation. A similar approach was used for construction of internal standards enabling the quantitation of the 35S promoter and NOS terminator sequences commonly used for regulating gene expression in transgenic crops [99]. Despite the proven suitability of these methods for application to certified reference materials, analysis of processed foods revealed that DNA degradation affects the amount of amplifiable target sequences and this leads to reduced recovery of DNA. Double competitive PCR systems were therefore needed to also assess the amounts of plant-specific target sequences as an endogenous reference, enabling normalization of the results and the analysis of processed and/or composite

231

232

11.4 Analytical Methods

foods [96]. Several plant-specific genes were characterized and competitive PCR systems for quantitation of the soy-specific lectin (le1) gene and the maize-specific invertase (ivr1) gene have been developed [97, 101]. Additional genes generally targeted as endogenous references are the maize-specific zein (ze1), the high mobility group (HMG) protein genes, and the rape specific acetyl-CoA carboxylase (BnAccg8) gene [101–105]. Detailed studies of the effect of DNA degradation in the course of heat treatment on the quantitation of transgenic maize by competitive PCR, and the normalization of results using an endogenous reference gene, have been performed [29, 101]. Quantitation of a single target sequence in unprocessed maize flour could be successfully used for determination of the proportion of transgenic maize on the basis of parallel analysis of certified standard flour mixtures. Determination of DNA concentrations (by UV absorption) in extracts of processed foods does not, however, enable differentiation between amplifiable and degraded DNA, and this led to severe discrepancies in the results obtained from single competitive quantitation. This drawback was overcome by the development of a complementary competitive PCR system designed for quantitation of an endogenous reference gene. Heat treatment continuously degrades DNA and this results in a severely reduced average fragment length (Fig. 11.2). To demonstrate that this process affects the target sequence of Bt maize to the same extent as any other region of the maize genome of comparable length, aliquots of a DNA mixture (10% Bt) were heat treated at 95 °C. A transgenic-specific sequence and a reference target sequence were quantified by competitive PCR (Fig. 11.3). The almost parallel decrease in the recovery of both target sequences forms the basis for dual competitive PCR. Thus, GMO proportions may be calculated on the basis of the ratio between the determined amounts of DNA sequences targeting the transgene and the reference gene, delivering near-constant values for the Btproportions in the starting material and in the thermally treated samples. Quantitation of GMO proportions consequently became independent of: 1. the presence of DNA other than from maize; and 2. the degradation of target sequences throughout processing

because degradation of transgene and reference gene were shown to occur in a parallel manner. The development of a competitive PCR system for the event-specific quantitation of Bt11 corn was an important milestone in improving the specificity of quantitation systems. This approach reduces the ambiguity of GMO detection resulting from the presence of similar expression cassettes in different transgenic crops or within one crop [88]. The 5 site of the integrated transgenic sequence in the Bt11 corn was characterized by use of inverse PCR technology and further used for development of a competitive PCR system covering the integration border. This labor-intensive approach requires extensive handling of PCR products, however, and involves a high risk of cross contamination. The time-consuming and extremely material-intensive technique requires several reaction mixtures for the measurement of one point of equivalence and visualization of PCR products

Recovery

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

Duration of heat treatment Fig. 11.3 Quantification of a heat-treated DNA mixture from conventional and Bt-maize (10%). Recovery of a transgene-specific target sequence (cryIA(b) gene, 212 bp) and an endogenous reference target sequence (ivr1 gene, 226 bp).

by gel electrophoresis, in combination with complex gel documentation and/or evaluation.

11.4.2.4 Real-time PCR Real-time PCR is the state-of-the-art technique for detection and quantification of DNA. This technique is based on use of a thermal cycler with an integrated optical unit which enables measurement of amounts of PCR product at every stage of the reaction. This is achieved by monitoring the increase in fluorescence caused by intercalation of DNA-binding dyes in the resulting PCR products or by the hydrolysis of hybridization probes labeled with a reporter and a quencher dye. The main disadvantage of using intercalating dyes is the unavoidable detection of nonspecific PCR products, for example primer dimers. Hydrolysis probes (e.g. TaqMan Probes) are synthetic oligonucleotides complementary to the target DNA. The principle of their detection relies on release of the reporter dye as hybridized probes are hydrolyzed by the 5 → 3 exonuclease activity of Taq DNA polymerase. The increase of fluorescence emitted by the reporter dye is proportional to the exponential amplification of target sequences. Other formats of hybridization probes (e.g. LightCycler Probes or molecular beacons) do not require hydrolysis to generate a signal and have also been successfully used for quantitation of DNA sequences [45, 106]. Because, during the first stages of amplification, PCR kinetics can be described as a steady exponential process, the starting copy number of target sequences can be extrapolated on the basis of a standard curve which describes the correlation between starting copy numbers and threshold cycles (Ct values) [107]. The construction of standard curves requires the analysis of external reference dilutions (absolute standards) with defined concentrations of target sequences. Several

233

234

11.4 Analytical Methods

methods for production of absolute standards have been described, although target sequences are usually cloned into a plasmid vector and used as template to generate a standard curve [108–110]. Accurate quantitation is only achieved when the amplification efficiency of the plasmid standards is equal to that of the target sequence within the genome of the host organism. This requirement is fulfilled when standard curves generated from plasmid standards and dilutions of genomic DNA have similar slopes. Efficiencies can be regarded as equal if the difference between the slopes is <0.1. A variety of methods have been established for quantitation of proportions of GMO in food raw materials, and have been validated in international interlaboratory trials [74, 88, 97, 111–118]. Kits for quantitation of transgenic soy (Roundup Ready) and maize (Maximizer Bt 176, Bt 11, Liberty Link T25, Yield Guard MON 810, Roundup Ready NK603 and GA21, StarLink and Herkulex) and Canola (Liberty Link) are commercially available. The first real-time PCR method to be applied for quantitative detection of a genetically modified organism in foods was described by Wurz et al. [97]. The method was used to detect a Roundup Ready soya-specific sequence and a plant-specific sequence within the lectin (le1) gene. Special attention was paid to avoiding significant differences in amplicon lengths and to keeping them as short as possible, meeting basic prerequisites for its application on processed foods. The approach was subsequently tested with certified reference materials containing 0.1%, 0.5%, and 2% transgenic soya; the results obtained were in good agreement with the output expected. Methods for quantitative detection of Bt 176 “Maximizer” maize and Roundup Ready soybean, targeting the cryIA(b) and the CP4 EPSPS transgenes, respectively, have also been introduced [116]. Endogenous reference targets used were the maize-specific zein (ze1) and the soya-specific lectin (le1) genes. For the first time, PCR conditions were optimized to enable the quantitation of transgenic and isogenic targets in one tube, thus eliminating variations other than those inherent in the Ct measurements. Pietsch and Waiblinger [113] described a real-time PCR method for quantitation of genetically modified soybean using LightCycler technology. Primers developed specifically anneal to the overlapping sequence between the cauliflower mosaic virus 35S promoter and the Petunia hybrida 5-enolpyruvylshikimate-3-phosphate synthase signal peptide. The soybean-specific lectin gene was used as reference. The linearity of the system was shown by using DNA dilutions from certified standard materials. Analysis of a soybean diet sample was used as an example of the application of this approach to manufactured foods. This method was subsequently validated [114], yielding diminishing relative confidence intervals at P = 95% from 37% to 9.3% with increasing transgenic content in the reference materials (0.1% RRS and 5% RRS, respectively). Interlaboratory testing has been performed with commercially available kits for quantitation of Roundup Ready soybean and Bt 176 maize [115]. These kits enable determination of GMO proportions in food samples, for Roundup Ready soya relying on the amplification of two 74 bp fragments from the functional insert and

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

from the soybean-specific lectin (le1) gene. For Bt 176, a 129-bp section of the Bt toxin gene and a 79-bp sequence of the maize high-mobility group protein gene (HMG) are amplified [119]. Although these methods are evidentially suitable for application to reference materials, several questions remain unanswered. In analysis of certified reference materials using the Bt 176 method, both real-time PCR systems had a slight tendency to overestimate the GMO content of all samples. The most questionable effect arises from the analysis of heat-sterilized kernels, which resulted in substantial underestimation of the proportion of GMO. The effect of technological factors on quantitation of GMO by real-time PCR was studied by Moreano et al. [120]. In a first approach, the effect of the particle size composition of maize milling products on the determination of GMO content was studied. Different milling fractions of maize – from coarse grits to fine flours – are used for industrial production of foods and foodstuffs. Similar fractions were prepared on the laboratory scale by grinding whole maize kernels and subsequently sieving the material through standard sieves. The particle-size compositions of the fractions obtained were characterized by use of a laser diffraction system. Application of two established methods for extraction of DNA from food for GMO analysis [38] revealed a strong correlation between the particle size of the milling fractions and DNA yields in the extracts – DNA yield increased with decreasing median particle size (Table 11.2). These results indicated that in composite products which contain conventional and transgenic material in different ingredients the ratios of DNA concentrations determined in the extracts may not reflect the proportions of GM material in the food sample. If the presence of GMO is limited to one of the ingredients, the proportions of DNA extracted from both ingredients would not reflect the actual weight proportions of GM material contained in the food sample. To confirm this assumption, four mixtures with a GMO content of 1% were prepared from different combinations of coarse grits and flour made from conventional and transgenic maize Bt 176 (Table 11.3).

Tab. 11.2 Extraction of DNA from maize milling products with different particle-size distributions. Milling fraction

Coarse grits Regular grits Meal Flour * **

Median particle size X50 (nm) ± CI(95%) 1049 ± 16 697 ± 41 287 ± 53 19 ± 2

Means from duplicate measurements Starting from 300 mg per sample

DNA concentration[*] (ng μL−1) Wizard extraction[**] CTAB extraction[**] 196 173 320 527

200 236 347 359

235

236

11.4 Analytical Methods Tab. 11.3 Quantification of Bt-maize contents in mixtures of milling products with different particle size distributions. Mixture

1 2 3 4 *

Bt 176 maize

Conventional maize

Coarse grits (mg)

Flour (mg)

3 – – 3

– 3 3 –

Coarse grits Flour (mg) (mg) 297 – 297 –

– 297 – 297

Bt-maize contents* ± CI(95%) [%] CTABExtraction**

WizardExtraction**

0.8 ± 0.5 1.4 ± 0.4 4.3 ± 1.1 0.2 ± 0.1

0.9 ± 0.4 1.0 ± 0.1 2.6 ± 0.8 0.3 ± 0.2

Kit: GeneScan, Bt 176 MaximizerTM Corn DNA Quantification System. Amplicon lengths: reference gene 79 bp, transgene 129 bp Starting from 300 mg sampling material

DNA was quantified by use of a commercially available real-time PCR quantitation kit which had been previously tested in an international ring trial (GeneScan, Bt 176 Maximizer Corn DNA Quantitation System [115]). Table 11.3 shows how quantitation results varied significantly, depending on the composition of the mixtures. Accurate quantitation of the adjusted GMO content was possible only in DNA extracts from mixtures in which conventional and transgenic material were present in the form of analogous milling fractions. DNA extracted from mixtures containing fractions with different particle size distributions led to severe overestimation or underestimation of the adjusted GMO content. Distortion of quantitative results was lower, but still substantial, if DNA was extracted using the Wizard extraction method rather than applying the CTAB–chloroform method. The effect of heat-induced DNA degradation on GMO quantitation results was also studied [120]. Distortion of quantitation results observed in interlaboratory testing of the commercially available kit for the quantitation of Bt 176 maize [115] led to the assumption that length differences between both target sequences might have been too high. This difference resulted in more rapid degradation of the GMO specific target sequence during heat treatment, thus making this method unsuitable for application to processed foods. In contrast with the Bt 176 maize method, accurate results were obtained from assessment of GMO content of a textured vegetable protein product using the Roundup Ready soya method, which uses target sequences of exactly the same length. To confirm this assumption, two different milling fractions obtained from Bt 176 maize (coarse corn grits and corn flour) were heated in boiling water for 60 and 120 min. The DNA extracts (Wizard method) were quantified using the above-mentioned kit. Results from calculation of recovery of GMO content on the basis of the Ct values obtained are listed in Table 11.4. Use of this kit to determine the GMO content of heat-treated products by real-time PCR again resulted in drastic underestimation of the GMO content. This distortion of the recovery of GMO content from processed samples confirmed observations made during the ring trial and could be ascribed to greater degrada-

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods Tab. 11.4 Distortion of the recovery of the GMO content of coarse grits and flour from Bt-maize in the course of heat-treatment. Duration of heat treatment (min) 0 60 120 *

Recovery of GMO content[*] ± SD (%) Recovery of GMO contents[**] ± SD (%) Coarse grits

Flour

Coarse grits

Flour

86 ± 21 56 ± 11 26 ± 12

71 ± 11 56 ± 13 46 ± 7

112 ± 4 120 ± 9 137 ± 13

114 ± 8 117 ± 4 126 ± 1

Bt 176 Maximizer Corn DNA Quantification System [115]. Amplicon lengths: reference gene 79 bp, transgene 129 bp Quantification method as described by Höhne et al. [111]. Amplicon lengths: reference gene 84 bp, transgene 68 bp

tion rates for the longer transgenic target sequence (104 bp) than for the reference target sequence (79 bp). This effect was more pronounced for heat-treated maize grits than for heat-treated flour. To confirm this suggestion that results from quantitation of GMO in processed products by real-time PCR could be affected by length differences between reference and transgenic target sequences, a second real-time PCR quantitation system [111] was used. In contrast with the previous method, the difference between the lengths of both target sequences was much smaller (16 bp) and the reference target sequence was longer than the transgene target sequence. Application of this method resulted in slight overestimation of GMO content (Table 11.4). This is in agreement with the postulated higher rates of degradation for longer target sequences. Because of the smaller length differences between target sequences, the amount of distortion in this instance was lower than that resulting from the previous method. Distortion of quantitation results was again greater for DNA from coarse maize grits than for DNA from maize flour. Another study of the effect of nucleic acid degradation on the determination of GMO content by real-time PCR was performed by analyzing samples from intermediate stages of a laboratory-scale process for the production from ethanol from maize [121, 122]. This example was chosen because it comprises a series of processes (mechanical stress, enzymatic hydrolysis, microbial fermentation, and thermal treatment) potentially contributing to DNA degradation. The process was started using a mixture of maize grits containing 10% of material derived from the transgenic line Bt-176. Samples were taken through the stages of mashing, enzymatic liquefaction and saccharification, yeast fermentation, and from the mash after distillation periods of 20 and 40 min. The content of GM maize was determined using three different real-time PCR systems (Fig. 11.4). Accurate results were obtained for control samples and the mashed raw materials. Analysis of samples from subsequent stages of processing resulted in increasing deviation of the GMO content from the true value if the quantification systems were affected by differences between the lengths of target and reference sequences. After reduction of the differ-

237

11.4 Analytical Methods 50

GMO content [%]

10 N.Q. N.Q.

N.Q.

Li qu ef ac Sa tio cc n ha rif ic at io Fe n r m D is en til ta le tio d n M a D sh is 20 til le m d in M as h 40 m in

m at er ia l M as hi ng aw R

238

Fig. 11.4 Comparison of results from quantification of DNA from corn Bt-176 in samples (10%) from intermediate stages of the process of ethanol production.

N.Q.

Method I Method II Method III

Method I: cryIA(b) gene 129 bp, HMGa gene 79 bp (Δl = −50 bp) [119]; Method II: 35S-CaMV promoter 68 bp, zein gene 84 bp (Δl = +16 bp) [111]; Method III: cryIA(b) gene 81 bp, HMGa gene 79 bp (Δl = −2 bp).

ence to Δl = −2 bp almost constant recovery of the actual proportion of GMO-derived material was achieved, even after high levels of processing. Corbisier et al. [123] investigated the effect of mixing processes (mechanical treatment) at different temperatures (thermal treatment) and different DNA extraction methods on the quantitation of Roundup Ready soybean flour. Certified reference material containing 1% GMO material was used as sample for DNA degradation to generate processed food. Trueness of the real-time PCR method for fragmented samples could be confirmed by using small amplicons (<100 bp). Overestimation of the most processed sample was ascribed to the DNA extraction method used (silica gel membrane) rather than to different degradation rates of reference and transgenic target. Yoshimura et al. [124, 125] determined the applicability of GMO quantitation to foods processed from maize and soy. Different lengths of amplicons for taxon-specific reference sequences were chosen to observe DNA degradation caused by heat treatment. Although similar lengths of taxon-specific and recombinant target were used distortion of the proportion of GM appeared in the early stages of heat treatment. The higher GC content of the reference target was regarded as additional proof of the thermal stability of DNA and the reason for greater degradation of the transgene target with the lower GC content [124]. Significant differences between results from GM quantification of the same samples were observed when two DNA extraction methods were compared [125].

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

In conclusion, the particle-size distribution of food components was found to have a measurable effect on the efficacy of DNA extraction. Overestimation and underestimation of the GMO content of composite foods may result, especially if conventional and transgenic components are added as fractions with different particle-size distributions. DNA in milling fractions with different median particle sizes was found to undergo different degradation kinetics, resulting in further problems in the analysis of composite and processed foods. The accuracy of quantification of GMO in thermally treated samples was strongly affected, because of different rates of degradation of recombinant and reference target sequences of different length. Results obtained from assessment of the performance of these assays lead to important criteria for future method development and for the design of validation studies. Especially in the establishment of standardized international procedures for quantitative analysis of GMO in foods, validation studies cannot be restricted to assessment of trueness and precision for (unprocessed) certified reference materials, because such performance characteristics may not be unconditionally transferable to results obtained from analysis of composite and/or processed samples. Therefore, procedures for the validation of quantitative assays for the surveillance testing of products within the food chain must include experiments to demonstrate that neither food composition nor processing will affect quantitative results. Future standard procedures for determination of the GMO content of processed products should target recombinant and taxon-specific sequences of almost equal lengths. Otherwise, the scope of the methods should be clearly limited to determination of the GMO content of unprocessed samples.

11.5 Conclusions

Immunoassay methods are rapid and cost-effective techniques for detection and quantitation of proteins expressed in genetically engineered crops. They are being successfully used to test raw agricultural materials, although their applicability to processed foods is severely limited by the sensitivity of proteins to technological treatment. Although it is rather unlikely that protein-based assays will become available for the complex spectrum of composite and processed foods, these methods will remain important for traceability and identity-preservation purposes and for characterization of raw material in the food chain. PCR-based methods for detection of specific DNA sequences lead to significantly greater analytical sensitivity. The flexibility of PCR has been exploited for the development of highly specific methods that enable not only detection of DNA but also identification; that is, they offer the potential to discriminate authorized from nonauthorized transgenic lines containing similar transgenic constructs. DNA quantitation techniques enable the determination of the ingredient-related GMO content of composite and processed foods, on the basis of the simultaneous assessment of DNA sequences specific for the genetic modification and for an

239

240

References

endogenous reference gene. The limitations imposed by the time-consuming double-competitive techniques have been overcome by the development of real-time PCR methods. It has, however, been revealed that commonly used technological processes can severely affect the accuracy of results from quantification of DNA, leading to distortion in the determination of GMO content. Because the amplifiable DNA content decreases during the course of food processing, it is imperative to ensure that breakdown of both reference and transgenic target sequences will occur in parallel. This requires the targeting of short amplicons of similar length (~100 bp), which can be detected even at stages of advanced processing. Quantitation methods have been tested almost exclusively on unprocessed raw materials. In the future, however, validation must include trials which prove the accurate quantitation of GMO content at several stages of food manufacture. Not only decrease in analytical sensitivity because of degradation of DNA during processing but also distortion of results because of technological factors must be taken into account. Another undeniable fact is that the copy number of a gene used as reference may vary, depending on the species. The effects of further breeding of GMO – and, especially, the crossing of GMO with different traits leading to progeny containing two or more genetic constructs – are major problems for quantitative analysis. “Gene stacking” will raise further questions about use of the correct reference materials and quantitation principles. The increasing complexity of GMO-derived material in composite and processed foods will make quantitation of a specific GMO at the ingredient level and testing for compliance with a de minimis threshold increasingly difficult.

References 1 Robinson C. (2001) Genetic modification technology and food; consumer health and safety. ILSI Europe Concise Monograph Series. ISBN 1-57881-125-2 2 Anklam E., Neumann D. (2002) Method development in relation to regulatory requirements for detection of GMOs in the food chain. J. AOAC Int. 85 (3); 754–756 3 ILSI Europe Novel Food Task Force in collaboration with the European Commission’s Joint Research Center (JRC) and ILSI International Food Biotechnology Committee. (2001) Method development in relation to regulatory requirements for detection of GMOs in the food chain. In: ILSI Europe report series, Summary report of a joint workshop held in December 2000; pp. 7–8. 4 Van den Eede G., Kay S., Anklam E. (2002) Analytical challenges: Bridging the

gap from regulation to enforcement. J. AOAC Int. 85 (3); 757–761 5 Miraglia, M., Berdal, K.G., Brera, C., Corbisier, P., Holst-Jensen, A, Kok, E.J., Marvin, H.J.P., Schimmel, H., Rentsch, J., van Rie, J.P.P.F., Zagon, J. (2004) Detection and traceablitiy of genetically modified organisms in the food production chain. Food and Chemical Toxicology, 42, 1157–1180 6 Regulation (EC) No 258/97 of the European Parliament and of the Council of 27 January 1997 concerning novel foods and novel food ingredients. Official Journal of the European Communities 14.02.1997, No L 043, pp 1–7 7 Council Regulation (EC) No 1139/98 of 26 May 1998 concerning the compulsory indication of the labelling of certain foodstuffs produced from genetically modified

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

organisms of particulars other than those provided for in Directive 79/112/EEC. Official Journal of the European Communities 03.06.1998, No L 159, pp 4–7 Commission Regulation (EC) No 49/2000 of 10 January 2000 amending Council Regulation (EC) No 1139/98 concerning the compulsory indication of the labelling of certain foodstuffs produced from genetically modified organisms of particulars other than those provided for in Directive 79/112/EEC. Official Journal of the European Communities 11.01.2000, No L 6, pp 13–14 Commission Regulation (EC) No 50/2000 of 10 January 2000 on the labelling of foodstuffs and food ingredients containing additives and flavourings that have been genetically modified or have been produced from genetically modified organisms. Official Journal of the European Communities 11.01.2000, No L 6, pp 15–17 Regulation (EC) No 1829/2003 of the European Parliament and of the Council of 22 September 2003 on genetically modified food and feed. Official Journal of the European Union, L 268/1. Regulation (EC) No 1830/2003 of the European Parliament and of the Council of 22 September 2003 concerning the traceability and labelling of genetically modified organisms and the traceability of food and feed products produced from genetically modified organisms and amending Directive 2001/18/EC. Official Journal of the European Union, L 268/24. Commission Regulation (EC) No 65/2004 of 14 January 2004 establishing a system for the development and assignment of unique identifiers for genetically modified organisms. Official Journal of the European Union, L10/5. Belitz H.-D., Grosch W., Schieberle P. (2004) Food Chemistry, 3rd revised edition. Springer, Berlin. Quillien L., Gaborit T., Gueguen J., Melcion J.P., Kozlowski A. (1990) ELISA as a tool for evaluating the denaturating effect of extrusion cooking on pea legumin (Pisum sativum L.). Sciences des Aliments 10; 429–442 Varshney G.C., Mahana W., Filloux A.M., Venien A., Paraf A. (1991) Structure of

24 25

native and heat-denatured ovalbumin as revealed by monoclonal antibodies: Epitopic changes during heat treatment. J. Food Sci. 56 (1); 224–233. Marín M.L., Casas C., Cambero M.I., Sanz B. (1992) Study of the effect of heat (treatments) on meat protein denaturation as determined by ELISA. Food Chem. 43; 147–150. Unglaub W., Müller R., Jemmi T., Stuker G. (1998) Erhitzungsnachweis an FleischKnochenmehl aus Nebenprodukten der Lebensmittelgewinnung mittels Enzymimmunologie. Fleischwirtschaft 78 (10); 1072–1078 Roux K.H., Teuber S.S., Robotham J.M., Sathe S.K. (2001) Detection and stability of the major almond allergen in foods. J. Agri. Food Chem. 49; 2131–2136 Lindahl T., Nyberg B. (1972) Rate of depurination of native deoxyribonucleic acid. Biochemistry 11: 3610–3618 Adam R.E., Zimm B.H. (1977) Shear degradation of DNA. Nucl. Acids Res. 4 (5); 1513–1537 Ausubel F.M., Brent R., Kingston R.E., Moore D.D., Seidman J.G., Smith J.A., Struh K. (1992) Current Protocols in Molecular Biology. Greene Publishing Associates and John Wiley and Sons, New York. ISBN 0-471-50338-x Thomson J. (2000) Joint FAO/WHO Expert Consultation on Foods Derived from Biotechnology, Topic 11: Gene Transfer: Mechanisms and Food Safety Risks. Biotech. 00/13 Klein J., Altenbuchner J., Mattes R. (1998) Nucleic acid and protein elimination during the sugar beet manufacturing process of conventional and transgenic sugar beets. J. of Biotech. 60; 145–153 Maniatis T., Fritsch E.F., Sambrook J. (1982) Molecular Cloning. CSH Press. Bauer, T., Weller, P., Hammes, W.P., Hertel, C. (2003) The effect of processing parameters on DNA degradation in food. Eur Food Res Technol, 217(4), 338–343. Ebbehøy K. F. und Thomsen P. D. (1991) Species Differentiation of Heated Meat Products by DNA Hybridization. Meat Sci. 30: 221–234 Ford M., Du Prat E., Barallon R. V., Rogers H. J., Parkers H. C. (1996) Detection of Genetic Modifications in Food. In:

241

242

References

Authenticity ’96, IFR, Norwich, September 1–3 1996. Poster/Conference Abstract Kingombe C.I.B., Lüthy E., Schlosser H., Howald D., Kuhn M., Jemmi T. (2001) A PCR-based test for species-specific determination of heat treatment conditions of animal meals as an effective prophylactic method for bovine spongiform encephalopathy. Meat Sci. 57; 35–41 Moreano F., Hotzel H., Sachse K., Engel K.-H. Quantification of DNA in thermally treated products. In: Book of Abstracts of the joint workshop on method development in relation to regulatory requirements for the detection of GMOs in the food chain. ILSI Europe Novel Food Task Force in collaboration with the European Commission’s Joint Research Centre (JRC) and ILSI International Food Biotechnology Committee. December 2000, Brussels, Belgium. Hupfer Ch., Mayer J., Hotzel H., Sachse K., Engel K.-H. (1999) The effect of ensiling on PCR-based detection of genetically modified Bt maize. Eur. Food Res. Technol. 209 (5); 301–304 Stave J.W. (2002) Protein immunoassay methods or detection of biotech crops: Applications, Limitations, and practical considerations. J. AOAC Int. 85 (3); 780–786 Lipp M., Anklam E., Stave J.W. (2000) Validation of an immunoassay for detection and quantitation of a genetically modified soybean in food and food fractions using reference materials: interlaboratory study. J. AOAC Int. 83 (4); 919–927 Adamczyk, J.J., Adams, L.C., Hardee, D.D. (2000) Quantification of cryIA(c) δ-endotoxin in transgenic BT cotton: Correlating insect survival to different protein levels among plant parts and varieties. Pro.-Beltwide Cotton Conf. 2; 929–932 Bookout, J. T., Joaquim, T. R., Magin, K. M., Rogan, G. J., Lirette, R. P. (2000) Development of a Dual-Label TimeResolved Fluorometric Immunoassay for the Simultaneous Detection of Two Recombinant Proteins in Potato. J. Agric. Food Chem. 48 (12); 5868–5873 Roda, A., Mirasoli, M., Guardigli, M., Michelini, E., Simoni, P., Magliulo, M. (2006) Development and validation of

a sensitive and fast chemiluminescent enzyme immunoassay for the detection of genetically modified maize. Anal. Bioanal Chem., 384(6), 1269–1275. Fearing P. L., Brown D., Vlachos D., Meghji M., Privalle L. (1997) Quantitative analysis of CryIA(b) expression in Bt maize plants, tissues, and silage and stability of expression over successive generations. Molecular Breeding 3; 169–176 Baumforth K.R., Nelson P.N., Digby J.E., O’Neil J.D., Murray P.G. (1999) Demystified... the polymerase chain reaction. Mol. Pathol. 52 (1); 1–10 Anklam E., Gadani F., Heinze P., Pijnenburg H., Van den Eede G. (2002) Analytical methods for detection and determination of genetically modified organisms in agricultural crops and plant-derived food products. Eur. Food Res. Tech. 214; 3–26 Gadani F., Bindler G., Pijnenburg H., Rossi L., Zuber J. (2000) Current PCR methods for the detection, identification and quantification of genetically modified organisms (GMOs) A brief review. Beitr. Tabakforsch. Int. 19 (2); 85–96 Barallon R. (1999) Review of DNA extraction methods. Proceedings of the European Research Project SMT4-CT96-2072: Development of methods to identify foods produced by means of genetic engineering. BGVV-Hefte, 05/1999. Peano, C., Samson, M. C., Palmieri, L., Gulli, M., Marmiroli, N. (2004) Qualitative and Quantitative Evaluation of the Genomic DNA Extracted from GMO and Non-GMO Foodstuffs with Four Different Extraction Methods. J Agric. Food Chem., 52(23), 6962–6968. Zimmermann A., Lüthy J., Pauli U. (1998) Quantitative and qualitative evaluation of nine different extraction methods for nucleic acids on soya bean food samples. Zeitschrift für Lebensmitteluntersuchung und Forschung 207; 81–90 Wurz A., Rüggeberg H., Brodmann P., Waiblinger H. U., Pietsch K. (1998) DNAExtraktionsmethode für den Nachweis gentechnisch veränderter Soja in Sojalecithin. Dt. Lebensm. Rundsch. 94; 159–161 Scheu P. M., Berghof K., Stahl U. (1998) Detection of pathogenic and spoilage

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods

micro-organisms in food with the polymerase chain reaction. Food Microbiol. 15; 13–31 Lantz P.-G., Abu Al-Soud W., Knutsson R., Hahn-Hägerdal B., Radström P. (2000) Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples. Biotechnology Annual Review Vol. 5 Wilson I. (1997) Inhibition and facilitation of nucleic acid amplification. Appl. Environm. Microbiol. 63 (10); 3741–3751 Mizushina Y., Yoshida S., Matsukage A., Sakaguchi K. (1997) The inhibitory action of fatty acids on DNA polymerase β. Biochim. Biophys. Acta 1336; 509–521 De Boer S. H., Ward L. J., Li X., Chittaranjan S. (1995) Attenuation of PCR inhibition in the presence of plant compounds by addition of BLOTTO. Nucl. Acids Res. 23; 2567–2566 Rossen L., Norskov P., Holmstrom K., Rasmussen O..F. (1992) Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA-extraction solutions. Int. J. Food Microb. 17: 37–45. Haymes, K.M., Ibrahim, I.A., Mischke, S., Scott, D.L., Saunders, J.A. (2004) Rapid isolation of DNA from chocolate and date palm tree crops. J. Agric. Food Chem., 52(17), 5456–5462. Holden, M. J., Blasic, J. R., Jr., Bussjaeger, L., Kao, C., Shokere, L. A., Kendall, D. C., Freese, L., Jenkins, G. R. (2003) Evaluation of extraction methodologies for corn kernel (Zea mays) DNA for detection of trace amounts of biotechnologyderived DNA. J Agric. Food Chem., 51(9), 2468–2474. Englund S., Ballagi-Pordany A., Bölske G., Johansonn K.E. (1999) Improved reliability of diagnostic PCR with an internal positive control molecule. Proc. 6th Intl. Coll. Paratuberculosis: Manning E.J.B., Collins M.T. (eds). Section 4 Diagnostic Applications and Approaches Spiegelhalter F., Lauter F.R., Russell J.M. (2001) Detection of genetically modified food products in a commercial laboratory. J. Food Sci. 66 (5); 634–640 Lipp M., Bluth A., Eyquem F., Kruse L., Schimmel H., Van den Eede G., Anklam E. (2001) Validation of a method based on

polymerase chain reaction for the detection of genetically modified organisms in various processed foodstuffs. Eur. Food Res. Technol. 212; 497–504 Holst-Jensen, A., Ronning, S.B., Lovseth, A. Berdal, K.G. (2003) PCR technology for screening and quantification of genetically modified organisms (GMOs). Anal Bioanal Chem, 375, 985–993. Wolf C., Scherzingern M., Wurz A., Pauli U., Hübner P., Lüthy J. (2000) Detection of cauliflower mosaic virus by the polymerase chain reaction: testing of food components for false-positive 35S-promoter screening results. Eur. Food Res. Tech. 210; 367–372 Stadler M., Hübner P. (1998) Probleme bei der Anwendung der 35S- und NOSPCR für die GVO-Analytik. Mitt. Gebiete Lebensm. Hyg. 89; 308–317 Pöpping B. (2001) Methods for the detection of genetically modified organisms: Precision, pitfalls and proficiency. International Laboratory 31(4); 23–29 Matsuoka T., Kuribara H., Takubo K., Akiyama H., miura H., Goda Y., Kusakabe Y., Toyoda M., Hino A. (2002) Detection of recombinant DNA segments introduced to genetically modified maize (Zea maize). J. Agri Food Chem. 50; 2100–2109 Meyer R. (1995) Nachweis gentechnologisch veränderter Pflanzen mittels der Polymerase Kettenreaktion (PCR) am Beispiel der Flavr Savr Tomate. Z. Lebensm. Unter. Forsch. 201; 583–586 Van Duijn G., van Biert R., BleekerMarcelis B., Peppelman H., Hessing M. (1999) Detection methods for genetically modified crops. Food Control 10 (6); 375–378 Hupfer C., Hotzel H., Sachse K., Engel K.-H. (1998) Detection of the genetic modification in heat-treated products of Bt maize by polymerase chain reaction. Z. Lebensm. Unters. Forsch. A 206; 203–207 Moreano, F., Pecoraro, S., Bunge, M., Busch, U. (2005) Development of synthetic DNA-standards for the quantitative screening of different genetically modified rapeseed lines via real-time PCR. Proceedings of the Euro Food Chem XIII conference, Macromolecules and Their Degradation Products in Food – Physi-

243

244

References

ological, Analytical and Technological Aspects, Hamburg, Germany, 21–23th September 2005, 1, 154–158. Golenberg E.M., Bickel A., Weihs P. (1996) Effect of highly fragmented DNA on PCR. Nucl. Acids. Res. 24 (24); 5026–5033 Hupfer C., Schmitz-Winnenthal J., Engel K.-H. (1999) Detection of genetic change in transgenic potatoes during the distillery process in ethanol production. Lebensmittelchemie, 53 (1); 13–14 Hellebrand M., Nagy M., Mörsel T. (1998) Determination of DNA traces in rapeseed oil. Z. Lebensm. Unters. Forsch. 206; 237–242 Straub J.A., Hertel C., Hammes W.P. (1999) Limits of a PCR-based detection method for genetically modified soya beans in wheat bread production. Z. Lebensm. Unters. Forsch. 208; 77–82 Moser M.A., Kniel B., Schmitz-Winnenthal J., Hupfer C., Engel K.-H. (1999) Einfluß verfahrenstechnischer Parameter auf den analytischen Nachweis gentechnisch veränderter Zutaten. Getreide, Mehl, Brot. Sonderdruck 6/99 Straub J.A., Hertel C., Hammes W.P. (1999) The fate of recombinant DNA in thermally treated fermented sausages. Eur. Food Res. Technol. 210; 62–67 Hurst C., Knight A., Bruce I. (1999) PCR detection of genetically modified soy and maize in foodstuffs. Mol. Breeding 5; 579–586 Vaitilingom M., Gendre F., Brignon P. (1998) Direct detection of viable bacteria, molds and yeasts by reverse transcriptase PCR in contaminated milk samples after heat treatment. Appl. Environ. Microbiol. 64 (3); 1157–1160 Busch U., Mühlbauer B., Böhm U., Liebl B. (2001) Gentechnisch veränderter Mais und Soja – qualitativer und quantitativer Nachweis. Deutsche Lebensmittel-Rundschau 97. Jahrgang, Heft 4 ILSI Europe Novel Food Task Force in collaboration with the European Commission’s Joint Research Centre (JRC) and ILSI International Food Biotechnology Committee. (2001) Method development in relation to regulatory requirements for the detection of GMOs in the food chain. In: ILSI Europe Report Series, Sum-

mary Report of a Joint Workshop held in December 2000; pp. 13 Berdal, K.G., Holst-Jensen, A. (2001) Roundup Ready soybean event-specific real-time quantitative PCR assay and estimation of the practical detection and quantification limits in GMO analyses. Eur. Food Res. Technol., 213(6), 432–438. Windels P., Theuns I., Dendauw J., Depicker A., Van Bockstaele E., De Losse M. (1999) Development of a line specific GMO detection method: A case study. Fac. Landbouwkd. Toegepaste Biol. Wet. 64 (5b); 459–462 Ronning, S.B., Vaitilingom, M., Berdal, K.G., Holst-Jensen, A. (2003) Event specific real-time quantitative PCR for genetically modified Bt11 maize (Zea mays). Eur. Food Res. Technol., 216(4), 347–354. Taverniers, I., Windels, P., Vaitilingom, M., Milcamps, A., Van Bockstaele, E., Van den Eede, G., De Loose, M. (2005) Event-Specific Plasmid Standards and Real-Time PCR Methods for Transgenic Bt11, Bt176, and GA21 Maize and Transgenic GT73 Canola. J Agric. Food Chem., 53(8), 3041–3052. Zimmermann A., Lüthy J., Pauli U. (2000) Event-specific transgene detection in Bt11 corn by quantitative PCR at the integration site. Lebensm. Wiss. und Technol. 33; 210–216 Collonnier, C., Schattner, A., Berthier, G., Boyer, F., Coue-Philippe, G., Diolez, A., Duplan, M. N., Fernandez, S., Kebdani, N., Kobilinsky, A., Romaniuk, M., de Beuckeleer, M., de Loose, M., Windels, P., Bertheau, Y. (2005) Characterization and event specific-detection by quantitative real-time PCR of T25 maize insert. J AOAC Int., 88(2), 536–546. Yang, L., Xu, S., Pan, A., Yin, C., Zhang, K., Wang, Z., Zhou, Z., Zhang, D. (2005) Event Specific Qualitative and Quantitative Polymerase Chain Reaction Detection of Genetically Modified MON863 Maize Based on the 5-Transgene Integration Sequence. J Agric. Food Chem., 53(24), 9312–9318. Holck A., Va M., Didierjean L., Rudi K. (2002) 5-Nuclease PCR for quantitative event-specific detection of the genetically modified Mon810 MaisGuard maize. Eur.

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods Food Res. Tech. 214; 449–453 91 Reischl U. and Kochanowski B. Quantita82 Hernandez, M., Pla, M., Esteve, T., Prat, tive PCR. Mol. Biology 3; 55–71 S., Puigdomenech, P., Ferrando, A. (2003) 92 Piatak M. Jr., Luk K.-C., Williams B., A specific real-time quantitative PCR Lifson J. D. (1993) Quantitative Comdetection system for event MON810 in petitive Polymerase Chain Reaction for maize YieldGard based on the 3-transAccurate Quantitation of HIV DNA gene integration sequence. Transgenic and RNA Species. BioTechniques 14; Res., 12(2), 179–189. 70–81 83 Huang, H. Y., Pan, T. M. (2004) Detection 93 Raeymaekers L. (1993) Quantitative PCR: of genetically modified maize MON810 Theoretical Considerations with Practiand NK603 by multiplex and real-time cal Implications. Analyt. Biochem. 214; polymerase chain reaction methods. 582–585 J Agric. Food Chem., 52(11), 3264–3268. 94 Gilliland G., Perrin S., Blanchard K., 84 Nielsen, C.R., Berdal, K.G., Holst-JenBunn H. F. (1990) Analysis of cytokine sen, A. (2004) Characterization of the 5 mRNA and DNA: Detection and quantitaintegration site and development of an tion by competitive polymerase chain event-specific real-time PCR assay for reaction. Proc. Natl. Acad. Sci. USA 87; NK603 maize from a low starting copy 2725–2729 number. Eur. Food Res. Technol., 219(4), 95 Hübner P., Studer E., Lüthy J. (1999) 421–427. Quantitative competitive PCR for the de85 Hernandez, M., Duplan, M.-N., Berthier, tection of genetically modified organisms G., Vaietilingom, M., Hauser, W., Freyer, in food. Food Control 10; 353–358 R., Pla, M., Bertheau, Y. (2004) Develop96 Hübner P., Studer E., Lüthy J. (1999) Dement and Comparison of Four Real-Time tection of genetically modified organisms Polymerase Chain Reaction Systems for in food. Nature Biotech. 17; 1137–1138 Specific Detection and Quantification of 97 Wurz A., Bluth A., Zelz P., Pfeifer C., Zea mays L. J Agric. Food Chem., 52(15), Willmund R. (1999) Quantitative analysis 4632–4637. of genetically modified organisms (GMO) 86 Yang, L., Pan, A., Zhang, K., Yin, C., in processed food by PCR based methods. Qian, B., Chen, J., Huang, C., Zhang, D., Food Control 10; 385–389 (2005) Qualitative and Quantitative PCR 98 Pietsch K., Waiblinger H.-U. (1999) Methods for Event-specific Detection of Kompetitive PCR zur Quantifizierung Genetically Modified Cotton Mon1445 “konventioneller” und transgener Lebensand Mon531. Transgenic Research, 14(6), mittelbestandteile. Lebensmittelchemie, 817–831. 53 (1); 13 87 Windels P., Taverniers I., Depicker A., 99 Hardegger M., Brodmann P., Herrmann van Bockstaele E., de Loose M. (2001) A. (1999) Quantitative detection of the Characterisation of the Roundup Ready 35S promoter and the NOS terminator soybean insert. Eur. Food Res. Tech. 213; using quantitative competitive PCR. Eur. 107–112 Food Res. Technol. 209; 83–87 88 Terry C.F., Harris N. (2001) Event-specific 100 Studer E., Rhyner C., Lüthy J., Hübner detection of Roundup Ready soya using P. (1998) Quantitative competitive PCR two different real time PCR detection for the detection of genetically modified chemistries. Eur. Food Res. Tech. 213; soybean and maize. Z. Lebensm. Unters. 425–431 Forsch. 270; 207–213 89 Huang, C.-C., Pan, T.-M. (2005) Event101 Hupfer C., Hotzel H., Sachse K., MorSpecific Real-Time Detection and Quantieano F., Engel K.-H. (2000) PCR-based fication of Genetically Modified Roundup quantification of genetically modified Bt Ready Soybean. J Agric. Food Chem., maize: single-competitive versus dual53(10), 3833–3839. competitive approach. Eur. Food Res. 90 Zimmermann K. und Mannhalter J. W. Technol. 212 (1); 95–99 (1996) Technical Aspects of Quantitative 102 Matsuoka T., Kubribara H., Akiyama H., Competitive PCR. BioTechniques 21; Miura H., Goda Y., Kusakabe Y., Isshiki 268–279 K., Toyoda M., Hino A. (2001) A multi-

245

246

References plex PCR method of detecting recombinant DNAs from five lines of genetically modified maize. J Food Hyg. Soc. Japan; 42 (1); 24–32 103 Studer E., Dahinden I., Lüthy J., Hübner P. (1997) Nachweis des gentechnisch veränderten Maximizer Mais mittels der Polymerase-Kettenreaktion (PCR) Mitt. Gebiete Lebensm. Hyg. 88; 515–524 104 Krech A.B., Wurz A., Stemmer Ch., Feix G., Grasser K.D. (1999) Structure of genes encoding chromosomal HMG1 proteins from maize. Gene 234; 45–50 105 Hernandez M., Rio A., Esteve T., Prat S., Pla M. (2001) A Rapeseed-Specific Gene, Acetyl-CoA Carboxylase, Can be Used as a Reference for Qualitative and Real-Time Quantitative PCR Detection of Transgenes from Mixed Food Samples. J. Agric. Food Chem. 49 (8); 3622–3627 106 Bustin S.A. (2000) Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Molec. Endocrinol. 25; 169–193 107 PE Applied Biosystems. (1997) Relative Quantification of Gene Expression. User Bulletin #2 108 Specht K., Richter T., Müller U., Walch., Werner M., Höfler H. (2001) Quantitative Gene Expression Analysis in Microdissected Archival Formalin-Fixed and Paraffin-Embedded tumor Tissue. Am. J. of Pathology 158; 419–429 109 Li X., Wang X. (2000) Application of realtime polymerase chain reaction for the quantitation of interleukin-1Ð mNA upregulation in brain isochemic tolerance. Brain Res. Protoc. 5; 211–217 110 Gut M., Leutenegger Ch., Huder J., Pedersen N., Lutz H. (1999) One-tube fluorogenic reverse transcription-polymerase chain reaction for the quantitation of feline coronaviruses. J. of Virological Methods 77; 37–46 111 Höhne M., Santisi C.R., Meyer R. (2002) Real-time multiplex PCR: An accurate method for the detection and quantification of 35S-CaMV promoter in genetically modified maize-containing food. Eur. Food Res. Technol. 215; 59–64 112 Taverniers, I.; Windels, P.; Van Bockstaele, E.; De Loose, M. (2001) Use of cloned DNA fragments for event-specific

quantification of genetically modified organisms in pure and mixed food products. Eur. Food Res. Technol. 213; 417–424 113 Pietsch K., Waiblinger H.-U. (2001) Quantification of genetically modified soybeans in food with the LightCycler system. Rapid Cycle Real-Time PCR, 385–389 114 Waiblinger H. U., Gutmann M., Hädrich J., Pietsch K. (2001) Validierung der Real-time PCR zur Quantifizierung von gentechnisch veränderter Soja. Deutsche Lebensmittel-Rundschau Heft 4. 115 Broll H., Zagon A., Butschke., Grohmann L. GVO Analytik: Validierung und Ringversuche. GMO Analytik heute. Symposium organized by Scil Diagnostics GmbH and GeneScan Europe AG. Frankfurt am Main, Germany, 23th January 2002 116 Vaitilingom M., Pijnenburg H., Gendre F., Brignon P. (1999) Real-Time PCR detection of genetically modified Maximizer maize and Roundup Ready soybean in some representative foods. J. Agric. Food Chem. 47; 5261–5266 117 Feinberg, M., Fernandez, S., Cassard, S., Bertheau, Y. (2005) Quantitation of 35S promoter in maize DNA extracts from genetically modified organisms using real-time polymerase chain reaction, part 2: interlaboratory study. J AOAC Int., 88(2), 558–573. 118 Fernandez, S., Charles-Delobel, C., Geldreich, A., Berthier, G., Boyer, F., Collonnier, C., Coue-Philippe, G., Diolez, A., Duplan, M. N., Kebdani, N., Romaniuk, M., Feinberg, M., Bertheau, Y. (2005) Quantification of the 35S promoter in DNA extracts from genetically modified organisms using real-time polymerase chain reaction and specificity assessment on various genetically modified organisms, part I: operating procedure. J AOAC Int., 88(2), 547–557. 119 ISO/DIN (2003) Foodstuffs – Methods of analysis for the detection of genetically modified organisms and derived products – Quantitative nucleic acid based methods. European Committee for Standardization (21570:2003). 120 Moreano, F., Busch, U., Engel, K.-H. (2005) Distortion of Genetically Modified Organism Quantification in Processed

11 Methods for Detection of Genetically Modified Organisms in Composite and Processed Foods Foods: Influence of Particle Size Compositions and Heat-Induced DNA Degradation. J. Agric. Food Chem., 53(26), 9971–9979. 121 Moreano, F. (2005) Development of techniques for the quantification of DNA from genetically modified organisms in processed foods. Dissertation Technical University Munich, Germany. 122 Moreano, F., Busch, U., Engel, K.-H. (2005) Einfluss der Lebensmittelverarbeitung auf die GMO-Analytik. In: H.-U. Waiblinger, U. Busch (Eds.) Neue Regelungen für gentechnisch veränderte Lebensmittel und Futtermittel. Schriftenreihe Lebensmittelchemische Gesellschaft-Band 27; Behr, Hamburg, Germany. 123 Corbisier, P., Trapmann, S., Gancberg, D., Hannes, L., Iwaarden, P., Berben, G.,

Schimmel, H., Emons, H. (2005) Quantitative determination of Roundup Ready soybean (Glycine max) extracted from highly processed flour. Anal. Bioanal. Chem., 383(2), 282–290. 124 Yoshimura, T., Kuribara, H., Matsuoka, T., Kodama, T., Iida, M., Watanabe, T., Akiyama, H., Maitani, T., Furui, S., Hino, A., (2005) Applicability of the quantification of genetically modified organisms to foods processed from maize and soy. J. Agric. Food Chem., 53(6), 2052–2059. 125 Yoshimura, T., Kuribara, H., Kodama, T., Yamata, S., Futo, S., Watanabe, S., Aoki, N., Iizuka, T., Akiyama, H., Maitani, T., Naito, S., Hino, A. (2005) Comparative studies of the quantification of genetically modified organisms in foods processed from maize and soy using trial producing. J Agric. Food Chem., 53(6), 2060–2069.

247

12 Mutations in Lactococcus lactis and their Detection Jan Kok and Bertus van den Burg

Summary

Many methods are available for permanent alteration or mutation, at will, of the genetic make-up of Lactococcus lactis. Strains with different properties can be selected from natural or industrial environments or can be isolated after application of a variety of classical mutation strategies to existing strains. In the last two decades we have seen the rapid development of sophisticated genetic engineering techniques for application to L. lactis. Recombinant DNA technology has advanced to such perfection that it is now, in principle, possible to introduce any mutation, small or large, or to insert genes from any origin into the genome of L. lactis. These possibilities open up a wide array of new applications of L. lactis, in food or feed production or for entirely new (medical) applications. In this review we describe in detail the potential of altering the genetic make up of L. lactis, by classical techniques and by recombinant DNA technology. We will examine the possibilities of distinguishing the strains made by the latter techniques, so-called genetically modified organisms, from “natural” mutants and will discuss methods for detection of genetically modified strains of L. lactis.

12.1 Introduction

Genetically modified organisms (GMOs) are organisms in which permanent DNA alterations have been introduced by recombinant DNA techniques. Over the last two decades, Lactococcus lactis has been made amenable to recombinant DNA technology. Tools to transform L. lactis, to introduce and express (foreign) DNA, to secrete (heterologous) proteins, and to mutate the chromosome by single and double crossover recombination strategies have all been developed. Constitutive or regulated promoters can be used to drive (foreign) gene expression. The culmination of genetic dissection of L. lactis was the determination in 2001 of the entire nucleotide sequence of the chromosome of L. lactis subsp. Lactis IL1403 [1a].

12 Mutations in Lactococcus lactis and their Detection

All of these advances unlock a wide spectrum of possibilities for introduction of desirable characteristics in the species or removal of undesirable traits. For instance, L. lactis has already been used to produce proteins from many different prokaryotic and eukaryotic organisms. The genetic methods can be used to alter the strains in such a way that they could be used for entirely new purposes. The big advantage of using recombinant DNA techniques over traditional methods of strain selection is that new traits can be introduced very rapidly and with great accuracy whereas in classical mutagenesis the background of the introduced mutation is mostly unknown. For several reasons it may be necessary to monitor the modified strain, either as such or in the products in which it is used. This review details a number of methods by which this can be done. We will first give an overview of the genetic changes that occur in this organism naturally and then will describe in detail the extent to which and by which methods the designed mutations can be distinguished from natural mutations and can be traced in food products.

12.2 The Composition of the Genome of Lactococcus lactis

The genome of an organism comprises its chromosome(s) and all extrachromosomal DNA elements. The genome of L. lactis consists of one circular chromosome and plasmid DNA. The nucleotide sequence of the entire chromosome of L. lactis subsp. lactis strain IL1403 has recently been determined and shown to contain 2,365 million base pairs [1a]. It contains 35.4% G and C nucleotides. In the chromosome 2310 open reading frames were detected, 64% (1482 ORFs) of which could be given a biochemical or biological function. There are 465 ORFs (20%) the products of which are hom*ologous with hypothetical proteins of unknown function and 363 ORF products (~16%) are, so far, specific for Lactococcus in that they are not similar other proteins. The nucleotide sequences of the genomes of three L. lactis subsp. cremoris strains, MG1363, SK11, and QA5, have been completed [1b–d]. The nucleotide sequences of the genomes of the two subspecies diverge by less than approximately 15% on average. Strains of L. lactis usually contain from one to more than ten different plasmid species, ranging in size from 2 to over 130 kb [2]. Many industrially important traits are encoded by these plasmids. Properties such as the capacity to ferment lactose or citrate, to degrade casein, to transport oligopeptides, to produce bacteriocin or exopolysaccharides, or to resist bacteriophages have all been connected to particular plasmids in particular strains. The relatively frequent loss of some of these traits was a first indication of the location of the corresponding genes on plasmids [2]. Interestingly, many of the functions that are plasmid-encoded in some strains have been found in other strains to be encoded by the chromosome. Other genomic features of L. lactis that are important to genetic flexibility and which will be discussed in more detail below are the presence of transposons in some strains, the wide distribution of a variety of different insertion sequence (IS)

249

250

12.4 Conjugation

elements on the chromosome and on plasmids, and the occurrence of prophages and remnants thereof.

12.3 Flexibility in the Genome of Lactococcus lactis

Bacterial genomes are currently regarded as relatively flexible structures that are under selective pressure and/or physical constraints to retain their overall organization [3]. It is possible evolution acts to optimize the genomic organization of bacterial species such that they are best adapted to the niches they occupy. Although L. lactis is found in different places in the environment, we only consider the dairy strains in this review. Dairy lactococci have small genomes and are optimally geared toward growth in milk. For example, many of their genes are involved in milk protein and milk sugar degradation and most dairy strains are multiple amino acid auxotrophs [4–6]. Several different genetic elements, for example temperate bacteriophages, conjugative transposons, and insertion sequences (IS) are involved in genome rearrangements in a large variety of bacterial species. Transposons are implicated in horizontal gene transfer and repetitive IS elements and ribosomal (rrn) operons provide targets for hom*ologous recombination [7, 8]. IS elements, transposons, and prophages have also been shown to add to or to be the causative agents of genomic rearrangements in L. lactis and will be discussed below. For the latest details on genome plasticity in L. lactis the reader is referred to an excellent review by Campo et al. [9]. Several natural gene-transfer systems shown to operate in L. lactis enable rapid and large modification of the genome, and thus contribute to the genetic (evolutionary) flexibility of the bacterium. Because an extensive review of these topics is beyond the scope of this paper, the reader is referred to very thorough reviews on the subject [10, 11a] which enable access to the original literature. Here the transfer systems will be dealt with only from the perspective of their contribution to genetic fluidity in L. lactis.

12.4 Conjugation

Conjugation of chromosomal markers and transfer of entire plasmids, specifying such traits as lactose fermentation, bacteriocin production and resistance, polysaccharide production, proteinase production and resistance to bacteriophages, have been observed in many strains of L. lactis. The mechanism of conjugal transfer in L. lactis has been most thoroughly examined for the lactose and/or proteinase plasmid in the closely related L. lactis strains ML3, NCDO712 and C2 (a review has been published elsewhere [11b]). Although the initial conjugation frequencies of the plasmid were extremely low (2 × 10−7 transconjugants per recipient), rare colo-

12 Mutations in Lactococcus lactis and their Detection

nies appeared with unusual colony morphology. Cells of these strains aggregated in broth cultures, forming large visible clumps of cells. These cells were shown to contain cointegrates of the lactose and/or proteinase plasmid with a so-called “sex factor” and were able to transfer the traits at very high frequencies of close to unity. The cointegrates are formed by insertion sequence (ISS1)-mediated transposition – ISS1 on the plasmid causes its integration at different positions in the “sex factor” with a duplication of the IS element. A clear difference between the situation in strains ML3 and NCDO712 is that the “sex-factor” in the former is, in fact, a lowcopy-number plasmid (pRS01). In NCDO712 (and in ML3) an equivalent (but not exact) copy of pRS01 is located on the chromosome, as was shown by pulse field gel electrophoresis. The cointegrates in the NCDO712 system differ slightly in size and were shown to contain different portions of chromosomal DNA as a result of one-ended transposition. Gasson et al. [12] have described the unidirectional transfer of chromosomal markers between strains, a phenomenon reminiscent of E. coli Hfr conjugation. Aggregation, enabling close physical contact and exchange of DNA between cells, is caused by the concomitant expression of the clu gene, which is present on the “sex factor” and is activated by cointegrate formation and a second chromosomal gene, agg. Another form of genetic mobility is provided by a Group II intron located on both pRS01 and the “sex factor” [13]. Group II introns are large self-splicing RNA structures which often function as mobile genetic elements. They move at low frequency from one site in the genome to a new genetic location. If, however, an intron-less copy of the genetic site occurs in a cell (for instance by conjugation), the intron very rapidly transposes from its original place to the empty site by a process called “intron homing” [14a]. The group II intron Ll.ltrB was recently targeted for efficient and stable insertion of malate decarboxylase (mleS) and tetracycline resistance (tetM) genes into the genome of L. lactis, demonstrating the usefulness of targeted group II introns as tools for food-grade insertion of (industrially important) genes in lactococci [14b].

12.5 Transduction

Transfer of chromosomal and plasmid DNA markers by transduction, the erroneous transfer of bacterial DNA from one bacterial cell to another by a bacteriophage, has also been described in L. lactis. Again, the phenomenon has been most extensively studied for L. lactis strains NCDO712 and C2. Although the mechanism was first described for virulent bacteriophages in the early 1960s [15, 16]; in later reports the phenomenon has almost exclusively been analyzed using temperate bacteriophages. Initial low-frequency transduction of the lactose plasmid led to a high frequency of transduction phenomenon in which an approximately 100-fold increase in frequency was caused by deletion of the plasmid to a size that fitted the head of the bacteriophage. For the lactose and/or proteinase plasmid pLP712 of

251

252

12.7 IS Elements and Transposons

strain NCDO712, inherent plasmid instability resulted in selection of the smaller variants by the transduction process. The instability of pLP712 could be attributed to the activity of IS elements on the replicon. Plasmids much smaller than the size limitation set by the phage head are also efficiently transduced [17]. Plasmid integration into the resident chromosome has been observed after lactose gene transduction and may be caused by IS-mediated transpositional recombination [17–19]. The transduction of chromosomal markers is rec dependent – after the erroneous packaging of a fragment of chromosomal DNA in the phage head and transfer it integrates into the proper location in the recipient chromosome by hom*ologous recombination [20]. Although HFT of chromosomal markers does not normally occur, elevated transduction of chromosomal markers, but not of plasmid genes, by the temperate bacteriophage BK5-T was observed when the phage was grown on its lytic host L. lactis subsp. cremoris H2 [21]. The presence on the H2 chromosome of several pac sites hom*ologous with the BK5-T pac site suggested that these facilitated insertion of chromosomal DNA fragments in the phage head to form transducing particles.

12.6 Transformation

Transformation by a natural process has not been observed in L. lactis even though the genes for the late competence proteins have been identified in the chromosome [1a]. Transformation under specific laboratory conditions is routinely employed. Protoplast transformation has been used in the past but the usual technique is electrotransformation of whole cells [11a]. Application of a high-potential electric field pulse to the cells is thought to transiently permeabilize the cellular membrane enabling passage of DNA. Specific growth conditions and treatment of cells, both meant to weaken the thick lactococcal cell walls, and the electroporation conditions have been examined to increase the number of genetically transformed cells, and transformation frequencies of 106 to 107 per microgram of DNA can be routinely obtained with plasmid-free laboratory strains. The development of electrotransformation has been instrumental in the rapid advancement of recombinant DNA technology in L. lactis.

12.7 IS Elements and Transposons

All strains of L. lactis contain one or more copies of several different insertion sequences (a review has been published elsewhere [22]). The number of different IS elements and the number of copies of each IS element in a strain varies widely but is several orders of magnitude many of the strains investigated. The IS elements are located on the chromosome and on a variety of plasmids [23]. They are typically between 800 bp and 2.500 bp in size, are flanked by inverted repeats, and usually

12 Mutations in Lactococcus lactis and their Detection

encode their own transposition functions. Replicative transposition of an active IS element in a plasmid leads to chromosomal integration of the entire vector between two copies of the IS element. IS elements cause many genetic rearrangements by providing sites for cointegrate and deletion formation, as we have seen above. They are involved in shuffling of genes or blocks of genes, changing their relative order, they can insert in genes and impair gene function, or they can be involved in activation of (silent) genes by providing promoter activity [24–26]. Their frequent association with important dairy functions suggests they have played an important role in the evolution of L. lactis and its adaptation to its current environment. By using probes of the different IS elements it has been possible to identify strains of L. lactis [10, 23]. In the genome sequence of strain IL1403 six different IS elements have been found, varying in numbers from 1 (IS982) to 15 (IS983), together comprising 42 kb of DNA. The nonrandom distribution of two of the IS elements (IS1077, always associated by IS904, and IS983) is suggestive of lateral transfer of a large segment of the genome of one Lactococcus donor carrying one of the IS elements to a recipient carrying the other [1a]. Some strains of both subspecies of L. lactis carry a chromosomally located transposon encoding sucrose-fermenting ability and the genes involved in the biosynthesis, secretion, and quorum sensing of the lantibiotic nisin [27, 28]. Insertion of the transposon in the chromosome occurs in an orientation-specific manner at one preferred site, although several secondary sites and multi-copy integration have been observed [29].

12.8 Lactococcal Phages as Sources of Genetic Plasticity

Above we have described examples of transfer of genetic information through (generalized) transduction by virulent and temperate bacteriophages. Most strains of L. lactis are lysogenic and carry one or more prophages [30, 31]. These prophages are relevant for the purpose of this review, because they integrate, during the lysogenic cycle, in the bacterial chromosome by hom*ologous recombination and, thus, change the genetic content of the newly lysogenized cell. On the one hand the prophages increase the metabolic burden on the cell and may even lyse the cell after prophage induction whereas on the other hand they may encode functions that increase the fitness of the lysogen. In other words, the host–prophage relationship is an example of a dynamic, albeit very delicate, genetic equilibrium [32]. Another level of plasticity is provided by the Group I intron scrI in one of the sequenced phages, r1t [33]. A gene on scrI specifies an endonuclease that enables the intron to move to an intronless allele by intron homing.

253

254

12.10 Mutations in Lactococcus lactois

12.9 An Example of Natural Genetic Flexibility: The L. lactis NCDO712 Family

Bacteria can be classified into two large groups on the basis of genomic stability. One group contains species with highly flexible genomes whereas the genomic organization of the species in the second group, which includes L. lactis, has been strongly conserved. Nevertheless, when comparing the physical maps of a number of L. lactis strains clear differences were observed at the level of the order of the genes on the chromosomes. A large inversion involving almost half of the chromosome was observed when L. lactis subsp. lactis IL1403 was compared with L. lactis subsp. cremoris MG1363 [34]. The latter strain is a plasmid free derivative of L. lactis subsp. cremoris NCDO712, an industrial strain originally isolated at the National Collection of Dairy Organisms in the UK in 1954. In the four decades it has been used by different laboratories the strain has undergone various spontaneous and/ or (chemically) induced mutations. The relationship between all the derivatives and their genetic constitution has been thoroughly studied [35] and exemplifies the speed at which, and the extent to which, large or smaller rearrangements can occur in the genome of L. lactis. In total, five major chromosomal rearrangements have been observed in different combinations in nine strains belonging to this genetic lineage – a large inversion involving approximately 50% of the chromosome, excision of an uncharacterized prophage, deletion of the prophage ΦT712, excision of part (30 kb) or the entire sex factor (60 kb), and deletion of some 25 kb of DNA encompassing the opp operon for oligopeptide uptake. The natural large inversion of half of the chromosome that is seen in some strains is caused by hom*ologous recombination between two inactive copies of the IS905 element [36]. A labile plasmid structure that is sometimes observed in the plasmid-free NCDO derivative MG1363 is, most probably, the excised “sex factor” and, again, an example of genetic instability. During the construction of the plasmid free NCDO 712 derivative MG1363 an intermediate strain was obtained that only carried the lactose and/or proteinase plasmid pLP712 [37]. This plasmid was highly unstable and readily gave rise to a variety of deletion variants, exemplifying yet another level of genetic instability in L. lactis that can have far-reaching effects, because many strains carry many different plasmids species.

12.10 Mutations in Lactococcus lactis as a Consequence of Environmental Factors and DNA Metabolism

The genetic material of any organism is repeatedly damaged by chemicals, thermal stress, and environmental radiation. The concurrent change in the chemical structure of the affected nucleotide can affect its base-pairing capacity and can lead to the incorporation of an incorrect nucleotide into DNA. Nucleotides can occur in two tautomeric forms, one of which can base pair with a nucleotide other than the

12 Mutations in Lactococcus lactis and their Detection

proper one and can, thus, cause incorrect base incorporation into DNA. Changes in DNA can also occur as a consequence of the normal process of DNA replication. Because of the specificity of DNA polymerase, however, the error rate during nucleotide incorporation is extremely low and an intrinsic check-up mechanism in DNA polymerase (its 3 to 5 exonuclease activity) removes incorrect nucleotides should they occur during the polymerization step. Replication mistakes do not always lead to single or point mutations – small deletions or insertions can also occur in DNA, especially in regions containing small repeated sequences. These sequences are responsible for replication slippage, in which the template strand and the newly synthesized DNA strand move relative to each other, and part of the sequence is either copied twice or not at all. Highly specialized proteins inside the cell constantly scrutinize the genetic material and accurately and very rapidly repair changes occurring in DNA. It is because of all of these processes acting in concert that mutations, permanent changes in DNA, are very rare events. In bacteria and eukaryotic organisms alike the estimated rate of mutation is approximately one nucleotide change per 109 nucleotides each time a DNA molecule is replicated. Put differently, a single bacterial gene of about 1000 base pairs will suffer from a mutation (not necessarily a deleterious one) once in approximately 106 generations.

12.11 Methods of Mutating the Genome of L. lactis

Methods of mutating the genome of L. lactis include treating cultures with ultraviolet light, base analogs, DNA-damaging agents, for example the alkylating agent EMS (ethylmethane sulfonate) or the intercalating agent ethidium bromide. By intelligent screening or selection procedures the desired mutant must be identified among the random mutants and most nonmutated cells. A drawback of these random procedures is that, apart from the sought after mutation, many more may be present elsewhere in the genome of the mutant. Depending on the chemical used, point mutations of a certain type, or deletions, are introduced into DNA. Plasmids have been more or less specifically removed from lactococcal strains by growing the cells under sub-optimum conditions for growth (starvation, acid conditions, high or low temperatures), by protoplast formation and subsequent regeneration, or by treating the cells with chemicals, for example ethidium bromide, that interfere with plasmid replication. Under some conditions one or more plasmid species can be removed from the cell and by applying the procedures repeatedly plasmid-cured derivatives of several strains of L. lactis have been obtained. Plasmid integration and the formation of smaller plasmids by deletion events have also been reported. All these mutation strategies are more or less random and the outcome, i.e. the exact nature and location of the mutation, cannot be controlled. Over the last two decades technology has been developed with which it is possible to direct the genetic modification of L. lactis very precisely. Several these techniques will now be discussed.

255

256

12.12 Genetic Engineering of Lactococcus lactis

Many tools are now available for genetic modification of L. lactis [38–40]. Plasmid vectors have been constructed for the cloning of genes. Vectors have also been made which select and analyze promoter and terminator structures and sequences necessary for secretion of proteins. Constitutive and regulatable promoters have been isolated and used to develop gene expression vectors with which it is possible to express genes of any origin in the organism [41]. Most of these vector systems have been developed to study fundamental questions about the molecular biology of L. lactis. These systems make use of traditional antibiotic selection markers and could, thus, never be used in food fermentation processes. For these systems to be applicable in the food industry they should be devoid of antibiotic resistance genes. So-called “food-grade” plasmids have been designed by using selectable genes derived form L. lactis. The nisin resistance determinant nsr could be used to select plasmid transformants on specific plates [42]. A plasmid carrying a lacF gene served as a dominant selection marker for growth of L. lactis YP2-5 on lactose. Strain YP2-5 carries a loss of function mutation in lacF in the chromosomal lac operon, which is complemented by plasmid-located lacF [43]. Another plasmid-strain combination for food-grade cloning and selection was devised on the basis of ochre and amber suppressor genes [44, 45] in combination with the proper stop codon (non-sense) mutations in an essential gene for purine metabolism. Because milk is purine free, the mutants cannot grow unless the plasmid carrying the suppressor gene is present. The suppressor genes specify an altered tRNA that recognizes the nonsense mutation as a sense codon and will restore functionality of the mutated gene product. Several other genes, e.g. thyA (for thymidilate synthase) and alr (for alanine racemase), have been proposed to serve in the proper genetic backgrounds as dominant markers in food-grade vector systems [46, 47]. An example of a system that makes use of a nonlactococcal selectable gene in L. lactis is provided by pLR333 and pLR334. These plasmids are based on the lactococcal theta replicon pWV02 and contain the scrA/B genes of Pediococcus pentosaceus for positive selection of plasmid-containing cells on sucrose plates [48]. Although these plasmids are not hom*ologous, i.e. they were not made by using L. lactis DNA exclusively (“self cloning”), they do consist of DNA from food microorganisms only. The chromosome of L. lactis has been made accessible by construction of a variety of insertion vectors [49–51]. The most versatile of several different insertion vectors, one based on the replicon of pWV01 [40], will be described in some more detail here to enable deeper treatment of the creation of calculated chromosomal mutations. A chromosomal insertion vector was made from the replicon of the cryptic lactococcal plasmid pWV01 (Fig. 12.1). This was done by physically separating the pWV01 origin of replication from the gene encoding the plasmid replication protein, RepA. The latter was placed in the chromosome of E. coli, B. subtilis, and L. lactis. In this way, a set of RepA+ helper strains was created expressing RepA and enabling replication of the pWV01 origin fragment (pORI). The origin fragment,

12 Mutations in Lactococcus lactis and their Detection

carrying an antibiotic resistance marker and a multiple cloning site, can be used as a chromosomal integration vector when it is endowed with a piece of chromosomal DNA. Single-crossover recombination results in integration of the entire plasmid at a precisely defined genetic locus. In this way genes can be specifically inactivated, or genes can be inserted at specific locations in the chromosome. The pORI derivatives pORI13 and pORI19 have been made to enable random mutagenesis of the chromosome [52, 53]. The vector pORI13 carries a promoterless lacZ gene that has been used to probe the chromosome for regions that are under environmental regulation [53]. A vector system for easy selection of double-crossover (replacement) recombination events has also been based on pORI – the presence of a constitutively expressed lacZ gene in pORI240 and pORI280, which differ only in the antibiotic resistance marker used for selection, enables easy visualization of the integration and excision events in a plate assay. A further refinement of these integration strategies was their combination with the pG+HOST series of plasmids, which provide the temperature sensitive RepAts in trans. This enabled separation of the two more or less rare events of transformation, and subsequent integration – the pORI derivative is introduced in a strain carrying the temperature-sensitive plasmid. A rise to the nonpermissive temperature and use of the proper antibiotics removes the pG+HOST plasmid, and thus RepAts, enabling subsequent selection of the integration event. Another way of mutating chromosomal genes randomly is to use several different vectors based on heterologous transposons, or plasmid pVE6007, or one of its derivatives [54]. The latter plasmids carry an active copy of the lactococcal insertion sequence ISS1 and repAts. After introduction of the plasmid in L. lactis and growth for a certain time at the permissive temperature the culture is switched to the nonpermissive temperature. Integrants carrying a copy of the entire plasmid in their chromosome as a result of ISS1 transposition activity are selected on antibiotic plates and tested for mutant phenotypes. The plasmid on the chromosome of a mutant is present between two copies of ISS1, a situation that is stable as long as the strain is kept at the nonpermissive temperature for plasmid replication. When a culture of the integrant is shifted to a temperature that enables replication of the RepAts plasmid, recombination can occur between the duplicated ISS1 copies. This process is, in fact, stimulated by rolling-circle replication of the plasmid and leads to excision of the plasmid while leaving a clean copy of ISS1 behind at the chromosomal location. In other words, the genetic locus is still mutated but now by the ISS1 element alone [54].

257

258

12.12 Genetic Engineering of Lactococcus lactis

Fig. 12.1 Schematic diagram of the two-step procedure used to achieve gene replacement (double cross-over) recombination. Plasmid pORI280 carries a selectable erythromycin resistance marker (Emr), a constitutively expressed gene for the E. coli enzyme β galactosidase (lacZ), and an origin for plasmid replication (ORI+). pORI280 cannot replicate independently but must be propagated in a host strain that expresses the plasmid replication protein RepA. L. lactis, B. subtilis, and E. coli host strains are available for this purpose. The red and taupe area represents the gene(s) of interest. This gene(s) has been taken from the lactococcal chromosome and inserted into pORI280 by general cloning techniques. The lollipop-andstar represents the intended mutation to be introduced into the lactococcal genome. This could be a single-nucleotide change or a small or large deletion. It could also be a whole (heterologous) gene(s), to be inserted in the lactococcal chromosome at the junction between the red and taupe DNA sequences. In step I the plasmid is introduced into L. lactis lacking

RepA. Using selection on plates containing Em and X-gal (a LacZ substrate that gives a blue color on hydrolysis by the enzyme), blue colonies are picked up that carry the entire plasmid in their chromosomes. These are the result of recombination (indicated by the cross) either through the red regions of hom*ology between the plasmid and the chromosome, as depicted here, or via the taupe regions (not shown). Subsequently these integrants are grown for several generations without Em and plated on media containing X-gal but lacking the antibiotic (step II). Among most blue colonies (the original mixture of the two integrant strains) colorless colonies appear in which resolution of the integrated structure has occurred via the two hom*ologous (red or taupe) DNA regions in the integrant chromosome. In the example given here, excision through the taupe regions results in the intended gene replacement. As is clear from this scheme, no vector DNA is left behind and the strain could, thus, be used in several rounds of gene replacement mutagenesis to create multiple mutations.

12 Mutations in Lactococcus lactis and their Detection

12.13 Strategies for Detection of Genetically Modified Lactococcus lactis

The detection of GMOs in food products has received major attention since the introduction of new plant varieties. In 1999 more than 40% of all corn and more than 45% of all soybean grown in the US were genetically modified variants [55]. Moreover, over 60% of all food products in US supermarkets contain GMOs. In recent years, public concern about possible threats related to these products has been growing. Many public debates about the environment and public health safety, e.g. gene flow to other organisms, destruction of agricultural diversity, increased allergenicity and gastrointestinal problems, are ongoing. Although hard evidence for such effects is often still lacking, or difficult to obtain, these concerns have spurred the search for procedures to detect even extremely small traces of GMO. Another reason for having such procedures at one’s disposal is to enable companies to safeguard protected technology and knowledge. Several tools are available for GMO detection, in particular related to crop GMOs, and many should also be applicable to the detection of modified lactococci. First, from the above discussion it is clear that large diversity can be brought about in the genetic material of Lactococcus by either natural processes or by a range of genetic engineering techniques. It would often be difficult or impossible to distinguish a lactococcal strain carrying a natural (spontaneous or UV or chemically induced) mutation or IS insertion from a strain in which the same mutation has been introduced by recombinant DNA technology. Insertion of new genetic material (one or more genes) is, of course, another matter although it could still be difficult if the new DNA is from a very related organism (i.e. a strain from the other subspecies). The most obvious genetic modification that is relatively simple to detect is insertion of a foreign DNA fragment that leads to the production of a heterologous protein. Such DNA sequences contain unique signatures that enable identification at the DNA level. The heterologous gene product can also be the target for detection. A selection of available DNA and protein-detection techniques will be discussed below.

12.14 Sample Preparation

The possibility of detecting GMOs in food or feed products largely depends on the absolute amount of GMO present. It is not unlikely that in a specific matrix containing lactic acid bacteria only a very small fraction consists of a GMO. Recent EU legislation stipulates that foods with a GMO content greater than 1% should be labeled as such [56]. Statistical approaches have shown that detection of such levels by most procedures currently employed, in particular PCR-based procedures, is seriously impaired by sampling procedures and errors [57–59]. For most, if not all, of the procedures described below the sampling and preparation of the material to be tested is most critical, with regard both to sensitivity and to the reproducibility that can be achieved [58]. The genetically modified lactococci to be detected are often

259

260

12.15 DNA-based Procedures

part of products consisting of a complex matrix of proteins and other biomolecules and containing many other lactococci and/or other microorganisms. During extraction of the nucleic acids extreme care must be taken to prevent their degradation. When protein-based procedures are employed degradation of the target GMO protein by proteases and peptidases must be prevented by all means possible. Many components of food products, for example proteins, fats, polyphenols, and polysaccharides [60] can interfere with the efficiency of PCR reactions, and agents often applied during nucleic acid preparation, for example ethanol and isopropanol, can also reduce PCR sensitivity [61]. Some contaminants can lead to PCR product artifacts that could be mistakenly classified as positives, whereas other contaminants or DNA degradation can give results that are difficult to interpret. To ensure efficient isolation of target nucleic acids, the extraction procedure should be validated extensively for each target and source material. In practice this means that several extraction procedures must be compared both with and without added (spiked) target molecules [62].

12.15 DNA-based Procedures

The techniques most commonly used for detection of modified or foreign DNA are the various formats of the polymerase chain reaction (PCR), Southern hybridization, and, more recently, DNA-microarray technology [63–65]. All these procedures rely on the sequence-specific hybridization of two strands of DNA and try to enhance and visualize the difference(s) between the nucleotide sequences of the GMO and the original strain. 12.15.1 Southern Hybridization

After transfer of isolated DNA to membranes, hybridization with labeled nucleic acid probes is used to detect hom*ologous sequences. Owing to the availability of novel labels (e.g. fluorescein, digoxigenin, biotin) these procedures have become much faster than with previously applied radioactively labeled (32P) probes. In general, the sensitivity of Southern blot-based procedures is significantly less that that of most PCR-based procedures. 12.15.2 PCR

In recent years many PCR-based procedures have been used for detection of lowabundance DNA, for example detection of small numbers of viruses in different biological materials, quantification of residual DNA in therapeutic products, diagnosis of infectious bacteria, and for identification of GMO products, for example Roundup Ready soy, in food products. Several procedures for GMO detection

12 Mutations in Lactococcus lactis and their Detection

have recently been discussed in great detail by Ahmed [66] and, therefore, will be described only briefly here. 12.15.3 Qualitative PCR

PCR enables one-millionfold amplification of specific DNA fragments. In principle, if a unique fragment can be selected it should be possible to detect a single GMO in a pool of 105 to 107 non-GMOs. After PCR the amplified DNA molecules can be visualized by agarose gel electrophoresis, high-performance liquid chromatography (HPLC), or capillary electrophoresis and their amount can be determined. The DNA fragment is often treated with restriction endonucleases, hybridized with a specific probe, or sequenced to confirm its identity. In addition, nested PCR procedures, in which two additional primers that specifically hybridize to the amplified DNA fragment are used in a second round of PCR, have been shown to yield reliable results [67]. The sensitivity of these PCR methods is strongly affected by the procedure used to prepare the starting material (see above). Poor template preparation, that is, isolation of GMO DNA to be amplified together with the DNA from most nonGMO strains, often results in much lower detection levels than those expected from theoretical calculations. 12.15.4 Quantitative PCR (End-point and Real-time)

In general, quantitative PCR procedures include a known concentration of an internal standard that is co-amplified with the target DNA fragment of the GMO. After quantitative end-point PCR both DNA fragments are separated and quantified. The starting concentration of the GMO can then be calculated by means of regression analysis. An additional advantage of this procedure is that the negative effects of contaminating agents on PCR efficiency can be seen directly by its effect on the amplification of the internal standard DNA. Quantitative real-time PCR has the major advantage that the concentration of amplified DNA in these procedures is proportional to PCR cycle number during the exponential phase of the reaction [68]. Real-time PCR requires the availability of techniques to monitor and determine PCR product formation during the PCR and, moreover, to differentiate between specific and nonspecific PCR products. Several sensitive detection reagents and tools have been developed recently, including exploitation of the double strand DNA binding dye SYBR Green I, hybridization of probes or fluorescence resonance energy tranfer probes (FRET), hydrolysis probes (also known as TaqMan technology [69, 70]), and molecular beacons [71].

261

262

12.15 DNA-based Procedures

12.15.5 Exhaustive Limiting Dilution PCR

This procedure does not use co-amplification of externally added reference DNA. On the contrary, the procedure must be optimized to the extent that amplification of an endogenous gene occurs in an all-or-nothing fashion. It must, furthermore, be assumed that one or more of the targets to be detected will give positive signals. Quantification is performed after comparison of many replicates of serial dilutions of the target material. At the largest dilutions where only some samples yield positive results Poisson statistics are exploited to determine the absolute number of targets in the sample [72]. Similar to most other PCR procedures exhaustive limiting dilution PCR is sensitive to contaminating agents. 12.15.6 Nucleotide Sequence-based Procedures

Determination of the nucleotide sequence can be the ultimate tool for detection of the presence of small alterations at the DNA level. For example, the occurrence of single-base substitutions or small deletions can be demonstrated unambiguously. Significant progress has been made in this field spurred, as it has been, by the importance of single-nucleotide polymorphism (SNP) analysis in genetic studies of diseases. Tools are available for large-scale high-throughput sequencing and accompanying analysis of the huge quantity of data obtained. Thus far, these tools have not been exploited for characterization of genetic diversity in lactic acid bacteria, but there does not seem to be a major technological restriction. Because SNP analysis technology requires PCR amplification of the DNA fragments to be sequenced, quantification is often hampered. 12.15.7 Microarrays

DNA microarrays have proven extremely powerful and sensitive tools for analysis of gene expression. Many gene-specific oligonucleotides or amplicons (the probes) can be coupled with different surfaces (often a glass support). Specific hybridization to the gene probes can be monitored after hybridization with, most often, fluorescently labeled target nucleic acids. Hybridization conditions can be chosen such that even single nucleotide mismatches can be detected. Nucleic acids are usually multiplied by PCR procedures, before hybridization, to yield sufficient material to enable detection. Consequently, quantification of the abundance of the gene(s) of interest is often difficult, as with other PCR-based procedures. This technology has already been successfully used for detection of pathogenic bacteria by specific identification of their virulence factors [73]. Conceivably, this technology will also prove extremely suitable for the detection of genetic diversity brought about by genetic engineering.

12 Mutations in Lactococcus lactis and their Detection

12.16 Protein-based Procedures

Most protein-based procedures for detection of GMOs exploit antibodies. Antibodies can be highly specific – for example, monoclonal antibodies recognize small and unique epitopes and are, therefore, extremely suitable for sensitive detection of protein. Because monoclonal antibodies usually interact with short peptide sequences (approx. nine amino acids) they can also be used to detect the presence of (partially) degraded GMO protein. Polyclonal antibodies, on the other hand, are often much more sensitive, which makes them more suitable if smaller amounts of GMO protein are expected [74]. 12.16.1 Western Hybridization

For Western hybridization procedures proteins from the sample of interest are first separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) then transferred to nitrocellulose or polyvinyl membranes. Interaction of antibodies specific for the protein of interest is accomplished and bound antibody is detected by exploiting an enzyme covalently attached to the antibody (e.g. horseradish-peroxidase or alkaline phosphatase), by applying a secondary antibody directed toward the first (GMO protein-specific) antibody, or by using Staphylococcus aureus protein A coupled with an easily assayable enzyme. These procedures are extremely specific and qualitative. Quantification is possible to a limited extent only if the detection limit of the GMO protein-specific antibody has been determined beforehand. A major disadvantage of Western hybridization procedures is the time needed to obtain results. 12.16.2 ELISA

Enzyme-linked immunosorbent assay (ELISA) procedures are much faster than Western hybridization, are very sensitive, and are much more suitable for quantitative purposes. Furthermore, when performed in microtiter plates ELISAs can easily be applied in high-throughput settings. A variation on the ELISA theme makes use of nitrocellulose strips in which a colored GMO protein-specific antibody is incorporated in a region of the strip that is dipped into the sample solution. On reaction of the antibody with the GMO protein, the colored complex diffuses through the strip matrix until it is bound in a region of the strip that carries a second GMO protein-specific antibody, forming a colored zone. A second zone in the strip containing an antibody against the color reagent provides a control for strip quality. It is to be expected that more and improved lateral flow strip-based procedures will become available in due course. In particular, improvement of the sensitivity is to be expected, e.g. by using fluorescence signal detection. One of the major advantages of strip-based procedures is their suitability for application in the field.

263

264

12.16 Protein-based Procedures

12.16.3 Protein Chips

Several procedures are available which depend on direct detection of protein–protein interaction. Different types of protein chip have been developed that combine extreme sensitivity and specificity, thereby enabling detection and quantification of minute amounts of protein. In brief, a protein is attached to a surface and its interaction with the specific protein to be detected is accompanied by the generation of a signal. Signals can be very diverse, e.g. the interactions can result in a detectable light emission (fluorescence) or lead to a measurable mass change. Such small mass changes can be monitored by use of optical detection procedures, for example surface plasmon resonance or Mach–Zehnder interferometer-based methods. Surface plasmon resonance (SPR) occurs when light is reflected under certain conditions from a conducting film at the interface between two media of different refractive index. In most commercially available systems the media are the sample and the glass of the sensor chip and the conducting film is a thin layer of gold on the chip surface. SPR causes a reduction of the intensity of reflected light at a specific angle of reflection. This angle varies with the refractive index close to the surface on the side opposite from the reflected light. When molecules in the sample bind to the sensor surface, the concentration, and therefore the refractive index at the surface, changes and an SPR response is detected (additional technical background information is given at www.biacore.com). Other optical sensor technologies , in particular Mach–Zehnder interferometer (MZI)-based procedures, could be even more advantageous because these have been shown to enable detection of much smaller molecules at even lower concentrations [75]. Optical sensor techniques could therefore provide the means for sensitive detection and quantification of GMO proteins in samples of diverse nature. Irrespective of which technique is used for detection, receptor biomolecules (e.g. specific antibodies) are immobilized on the surface of the sensor chip and the ligand (GMO molecule) is introduced into the flow system that is applied to the surface. The specific binding of the ligand results in mass change which can be monitored. 12.16.4 Two-dimensional Gel Electrophoresis and Mass Spectrometry

Two-dimensional (2D) gel electrophoresis techniques are extensively used to analyze and compare the protein content of biological samples. The proteins are first separated on the basis of their charge (first dimension) and then on the basis of the molecular weight (second dimension) by means of SDS-PAGE. After staining, a pattern of unique spots is obtained, each spot representing a specific protein. In principle this procedure can be used to screen for the occurrence of novel protein (variants) resulting from genetic modification. A major drawback of this procedure is the large variation in protein content that results from the differential expression of endogenous genes caused by environmental stimuli. Two-dimensional gel

12 Mutations in Lactococcus lactis and their Detection

electrophoresis is, moreover, still laborious and time-consuming. It is of utmost importance to standardize the procedures for sampling and sample preparation. Capillary electrophoresis techniques that can assist in the automation of protein separation have recently been developed [76]. In combination with protein separation by (2D) SDS-PAGE or capillary electrophoresis, mass spectrometric techniques have been developed that enable automated determination of the molecular weight of large numbers of proteins in any sample. After treatment of the proteins by specific proteases before mass spectrometric molecular weight determination, the amino acid content and/or the amino acid sequence can be assigned unambiguously. Because of the rather high costs of these procedures it is not likely these techniques will be used for GMO detection on a large scale, unless further improvements of selectivity and automation are achieved.

12.17 Conclusions

With the genetic engineering technology described above it is now possible to insert any DNA fragment in the chromosome of L. lactis. Conversely, entire genes or operons can be deleted from the genome by using the same strategies. By replacement recombination genetic changes as small as single-nucleotide mutations can be introduced without leaving any trace of vector DNA used to make the genetic changes. For many of these changes, apart from the insertion of heterologous genes, one cannot distinguish whether they are the result of a natural mutation or genetic engineering. Of course, if it were requested by industry, legislative bodies, or the consumer, any mutation made by engineering technology could be labeled as such by introducing, together with the mutation, a genetic “bar code”, in much the way as yeast mutants have been labeled [77]. Such a genetic label would identify the mutation, could be used to identify the producer of the mutant, and would provide additional possibilities for the design of specific PCR identification strategies. Although many tools can be used to detect changes in the genome of lactic acid bacteria it is clear that selection of the most suitable tool will be case-dependent. Because most procedures are technically complex much care should be taken in interpretation of the results. Extensive validation studies will be needed and, preferably in our opinion, these analyses should be performed in independent and highly specialized research institutions or laboratories.

265

266

References

References 1 (a) Bolotin, P. Wincker, S. Mauger, O. Jaillon, K. Malarme, J. Weissenbach, S.d. Ehrlich, A. Sorokin, Genome Research, 2001, 1, 1–23; (b) J. Kok, G. Buist, A. L. Zomer, S.A.F.T. van Hijum, O.P. Kuipers. FEMS Microbiol. Rev. 2005, 29, 411–433; (c) B. C. Weimer, L. McKay, K. Baldwin, B. Ganesan, Y. Xie, D. Chen. Eighth Symposium on Lactic Acid Bacteria, Book of Abstracts, 2005, L077; (d) A. Bolotin, B. Quiquis, A. Sorokin, S. D. Ehrlich. Eigth Symposium on Lactic Acid Bacteria, Book of Abstracts, 2005, L015. 2 L.L. McKay, Antonie van Leeuwenhoek, 1983, 49, 259–274. 3 S. Casjens, Annu. Rev. Genet. 1998, 32, 339–377. 4 W.M. de Vos, Lactic acid bacteria, genetics, metabolism and application, Kluwer Academic Publishers, the Netherlands, 1996. 5 J. Kok, W.M. de Vos, Genetics and Biotechnology of lactic acid bacteria, Blackie Academic and Professional, UK, 1994. 6 E.R.S. Kunji, I. Mierau, A. Hagting, B. Poolman, W.N. Konings, Lactic acid bacteria, genetics, metabolism and application, Kluwer Academic Publishers, the Netherlands, 1996. 7 M. Syvanen, Bacterial genomes: physical structure and analysis, Chapman and Hall, New York, 1997. 8 S.L. Liu, K.E. Sanderson, Proc. Natl. Acad. Sci. 1996, 93, 10303–10308. 9 N. Campo, M. Dias, M-L. Daveran-Mingot, P. Ritzenthaler, P. Le Bourgeois, Lactic acid bacteria, genetics, metabolism and application, Kluwer Academic Publishers, the Netherlands, 2002. 10 M.J. Gasson, FEMS Microbiol. Rev. 1990, 87, 43–60. 11 (a) M. J. Gasson, G.F. Fitzgerald, Genetics and Biotechnology of lactic acid bacteria, Blackie Academic and Professional, UK, 1994; (b) M. J. Gasson, C. A. Shearman. IN: The Lactic Acid Bacteria. Vol. 3: Genetics of Lactic Acid Bacteria (Eds. BJB Wood, PJ Warner), 2003, Kluwer Academic/Plenum Publishers, New York. 12 M.J. Gasson, J-J. Godon, C. Pillidge, T.J. Eaton, K. Jury, C.A. Shearman, Int. Dairy J. 1995, 5, 757–762.

13 G.M. Dunny, L.L. McKay, Lactic acid bacteria, genetics, metabolism and application, Kluwer Academic Publishers, the Netherlands, 1999. 14 (a) M. Belfort, P.S. Perlman, J. Biol. Chem. 1995, 270, 30237–30240; (b) C. L. Frazier, J. San Filippo, A. M. Lambowitz, D. A. Mills. App. Environ. Microbiol. 2003, 69, 1121–1128. 15 W.E. Sandine, P.R. Elliker, L.K. Allen, W.C. Brown, J. Dairy Sci. 1962, 45, 1266–1271. 16 L. K. Allen, W.E. Sandine, P.R. Elliker, J. Dairy Sci. 1963, 30, 351–357. 17 G.F. Fitzgerald, M.J. Gasson, Biochimie, 1980, 70, 489–502. 18 L.L. McKay, K.A. Baldwin, Appl. Environ. Microbiol., 1978, 36, 360–367. 19 S. Swindell, H.M. Underwood, M.J. Gasson, J. Gen. Microbiol. 1993, 20 D.G. Anderson, L.L. Mckay, J. Bacteriol. 1983, 155, 930–932. 21 B.E. Davidson, I.B. Powell, A.J. Hillier, FEMS Microbiol. Rev. 1990, 87, 79–90. 22 D.A. Romero, T.R. Klaenhammer, J. Dairy Sci., 1993, 76, 1–19. 23 A. Schäfer, A. Jahns, A. Geis, M. Teuber, FEMS Microbiol. Lett. 1991, 80, 311–318. 24 M. Shimizu-Kadota, M. Kirki, H. Hirokawa, N. Tsuchida, Mol. Gen. Genet. 1985, 200, 193–198. 25 P-J. Cluzel, A. Chopin, S.D. Ehrlich, M.-C. Chopin, Appl. Environ. Moicrobiol. 1991, 57, 3547–3551. 26 H.M. Dodd, N. Horn, Z. Hao, M.J. Gasson, Appl. Environ. Microbiol. 1992, 58, 3683–3693. 27 M.J. Gasson, FEMS Microbiol.Lett., 1984, 21, 7–10. 28 N. Horn, S. Swindell, H.M. Dodd, M.J. Gasson, Mol. Gen. Genet. 1991, 228, 129–135. 29 P.J.G. Rauch, W.M. de Vos, J. Bacteriol., 1992, 174, 1280–1287. 30 B.E. Davidson, I.B. Powell, A.J. Hillier, FEMS Microbiol. Rev., 1990, 87, 79–90. 31 T.R. Klaenhammer, G.F. Fitzgerald, Genetics and Biotechnology of lactic acid bacteria, Blackie Academic and Professional, UK, 1994.

12 Mutations in Lactococcus lactis and their Detection 32 F. Desiere, S. Lucchini, C. Canchaya, M. Ventura, H. Brüssow, Lactic acid bacteria, genetics, metabolism and application, Kluwer Academic Publishers, the Netherlands, 2002. 33 A. Nauta, PhD Thesis, University of Groningen, Groningen, the Netherlands, 1997. 34 P. Le Bourgeois, M. Lautier, L. van den Berghe, M.J. Gasson, P. Ritzenthaler, J. Bacteriol. 1995, 177, 2840–2850. 35 P. Le Bourgeois, M-L. Daveran-Mingot, P. Ritzenthaler, J. Bacteriol. 2000, 182, 2481–2491. 36 M-L. Daveran-Mingot, N, Campo, P. Ritzenthaler, P. Le Bourgeois, J. Bacteriol. 1998, 180, 4834–4842. 37 M.J. Gasson, J. Bacteriol. 1983, 154, 1–9. 38 W.M. de Vos, G.F.M. Simons, Genetics and Biotechnology of lactic acid bacteria, Blackie Academic and Professional, UK, 1994. 39 K. Leenhouts, G. Venema, Plasmids, a practical approach, Oxford University Press, UK, 1993. 40 K. Leenhouts, G. Venema, J. Kok, Methods in Cell Science, 1998, 20, 35–50. 41 W.M. de Vos, Curr. Opin. Microbiol. 1999, 2, 289–295 42 B.R. Froseth, L.L. McKay, J. Dairy Sci. 1991, 74, 1445–1453. 43 W.M. de Vos, P. Vos, G. Simons, S. David, J. Dairy Sci. 1989, 72, 3398–3409. 44 F. Dickely, D. Nilsson, E. Bech Hansen, E. Johansen, Mol. Microbiol. 1995, 15, 839–847. 45 K. I. Sorensen, R. Larsen, A. Kibenich, M.P. Junge, E. Johansen, Appl. Environ. Microbiol. 2000, 66, 1253–1258. 46 P. Ross, F. O’Gara F, S. Condon, Appl. Environ. Microbiol. 1990, 56, 2164–2169 47 P. Bron, S. Hoffer, J. Lambert, J. Delcour, W.M. de Vos, M. Kleerebezem, P. Hols, Streptococcal Genetics, 2002, P. 33. 48 R. Kiewiet, Thesis, University of Groningen, Groningen, the Netherlands, 1996. 49 K. Leenhouts, J. Kok, G. Venema, Appl. Environ. Microbiol. 1989, 55, 394–400. 50 M.C. Chopin, A. Chopin, A. Rouault, N. Galleron, Appl. Environ. Microbiol., 1989, 55, 1769–1774. 51 H. Israelsen, E.B. Hansen, Appl. Environ. Microbiol. 1993, 59, 21–26.

52 J. Law, G. Buist, A. Haandrikman, J. Kok, G. Venema, K. Leenhouts, J. Bacteriol. 1995, 177, 7011–7018. 53 J.W. Sanders, G. Venema, J. Kok, K. Leenhouts, Mol. Gen. Genet. 1998, 257, 681–685. 54 E. Maguin, H. Prevost, S.D. Ehrlich, A. Gruss, J. Bacteriol. 1996, 178, 931–935. 55 R.N. Beachy, Science 1999, 285, 335. 56 European Commision. 2000 Official Journal L 006, 13–14. 57 S. Kay & G. van den Eede, Nature Biotechnol. 2001, 19, 405. 58 J. Gilbert, Sampling of raw materials and processed foods for the presence of GMOs. Food Control 1999, 10, 363–365. 59 J. Gilbert, Food Control, 1999, 10, 363–365. 60 A. Gasch, In Foods produced by Modern Genetic Engineering. (Schreiber, F.A., & Bögle, K.W. eds) 2nd Status Report, 1997, pp 90–97, BgVV-hefte. 61 Qiagen, Critical factors for successful PCR. Practical Guidelines Technical Literature, 1999. 62 A. Lovatt, Applications of quantitative PCR in the biosafety and genetic stability assessment of biotechnology products. Rev. Mol. Biotechnol. 2002, 82, 279–300. 63 J. Sambrook, & D. Russel, Molecular Cloning: a Laboratory Manual (3rd edn), 2000, Cold Spring harbor Laboratory Press. 64 F. E. Ahmed, J. Environ. Sci. Health, 1995, C11, 1–51. 65 M. Hertzberg, M. Sievertzon, H. Aspeborg, P. Nilsson, G. Sandberg & J. Lundeberg, Plant J., 2001, 25, 585–591. 66 F. E. Ahmed, TiB, 2002, 20, 215–223. 67 A.M.A. van Hoef, E.J. Kok, E. Bouw, H.A. Kuiper & J. Keijer, Food Addit. Contam., 1998, 15, 767–774. 68 F.E. Ahmed, Environ. Sci Health C18, 2000, C18, 75–125. 69 K.J. Livak, S.J.A. Flood, J. Marmaro, W. Giusti & K. Deetz, PCR Methods Appl., 1995, 4, 357–362. 70 C.A. Heid, J. Stevens, K.J. Livak & P.M. Williams, Genome Res. 1996, 6, 986–996. 71 J.A. Vet, B.J. Van der Rijt & H.J. Blom, Expert Rev Mol Diagn., 2002, 2, 77–86. 72 P.J. Sykes, In The PCR Technique: Quantitative PCR (Larrick , J.W. ed.) 1998, pp 81–93, Eaton Publishing Co.

267

268

References 73 V. Chizhikov, A. Rasooly, K. Chumakov & D.D. Levy, Appl. Environ. Microbiol, 2001, 67, 3258–3263. 74 G.M. Brett, S.J. Chambers, L. Huang & M.R.A. Morgan, Food Control 1999, 20, 401–406.

75 G. Gauglitz, Anal. Bioanal. Chem. 2005, 381, 141–155. 76 I.V. Kourkine, C.N. Hestekin, B.A. Buchholz & A.E. Barron, Anal. Biochem. 2002, 74, 2565–2572. 77 D.D. Shoemaker, D.A. Morris, M. Mittmann, Nature Genetics 1996, 14, 450–456.

13 Methods for Detection of Genetically Modified Microorganisms used in Food Fermentation Processes Walter P. Hammes, Christian Hertel, and Torsten Bauer

13.1 Introduction

Detection methods for genetically modified plants have been developed and their reliability has been established [1–4]. For several reasons these methods cannot, without modification, be applied to microorganisms. For example, because crops are already on the market, the methods can be adapted to the specific modification and validated. In plants, elements such as the marker genes, promoter sequences, and terminators used for the construction are well defined and still rather limited in number. The phenotype of the genetically modified plants, for example resistance to insects or viruses, can, furthermore, usually be detected easily. In contrast, no genetically modified microorganism has achieved such status that its admission for release and placing on the market has been applied for, and thus real examples are missing. There are, therefore, no validated results for detection of legally approved genetically modified microorganisms (GMM). Such detection usually relies on available experience at tracing of traits at the genomic and phenotypic levels. A genetically modified Lactobacillus curvatus can serve as an example of such treatment. This GMM harbors a gene from L. sakei coding for a catalase [5] and has been used to establish a method in the official collection of methods according to § 35 of the German food act for detection of GMM in a food (fermented sausage). This method will be described in more detail below. Of great importance for detection is also the special nature of microorganisms and, especially, of prokaryotes which must to be taken into consideration when targeting specific traits; this also will be treated below. To change properties such as the regulation of gene expression, self-cloning is a rather simple method that leads to a rearrangement of the genome without introduction of genetic DNA from another strain or species. The use of these modified organisms in a contained environment is not within the scope of genetic modification according to Directive 90/219 EC. It does, however, fall under the definition of genetic modification on release of the organisms. A genetically modified yeast used for production of bread is an example of an organism which was approved

270

13.1 Introduction

by the ACNFP [6]. No corresponding self-cloned crops can be produced with the methods currently available. Clearly, proof of an illegal modification by self-cloning is beyond practicability – i.e. the modification can be traced but not unambiguously related to gene technology. Intermediate genetic modification of a strain then reconstitution of its wild type condition is closely related to self-cloning. An example was provided by Curic et al. [7], who described the introduction of a plasmid encoding the ilv genes for synthesis of branched-chain amino acids, rendering the constructs auxotrophic. The construct provides a means of facilitating screening for mutants of the Ald− (acetolactate decarboxylase) phenotype. The mutants were finally selected and cured from the plasmid. The resulting strain is a suitable starter organism for production of fermented dairy products with enhanced diacetyl flavor. Again, this type of genetic modification escapes detectability. Parts of the properties of microorganisms are encoded on extra-chromosomal elements. These so-called plasmids occur in greater numbers, may encode properties of technological or health-related importance, and may contribute to high levels of expressed gene products. Plasmids can be exchanged between different organisms by conjugation. In the course of that horizontal gene transfer (HGT) genetic information spreads within microbial associations. Two further mechanisms also contribute to HGT. Transduction is mediated by bacteriophages which, on disintegration of the host bacteria, co-transfer the genetic material of the virus and parts of the host’s DNA to a new host. The nucleic acid content of the phage particle may become integrated into the genome of the new host bacterium, which then becomes a lysogenic strain carrying a prophage together with its recently acquired DNA sequences. Finally, by transformation, free DNA is taken up by a bacterium and becomes integrated into the genome and expressed. These microbe-specific HGT events must be kept in mind when the presence of a genetic modification must be detected in a microorganism and related to genetic modification. First, the specific sequence may have been acquired as a result of natural HGT. Second, the modification, once performed, may be subject to rearrangements in the genome, which interferes with the detectability of genetic modification. These rearrangements occur especially frequently in bacteria and are mediated by, for example, insertion elements and transposons. These frequent HGT processes and genomic rearrangement processes result in plasticity of the bacterial genome, which must be seen as an inherent property of microorganisms. To detect a specific property at the genotype or phenotype level it must be known that this property is unambiguously the result of a genetic modification. As shown in Fig. 13.1, the levels to which detection of the GMM can be directed differ in their unambiguity. Ambiguity is highest at the nucleic acid level. PCR-based or hybridization techniques can provide unambiguous results, as far as this is possible with microorganisms. At the phenotype level, on the other hand, and especially on application of technical or biological processes to the food, the ambiguity of detection increases. When methods are being developed for detection of GMM in food the focus is, therefore, on methods targeting the genomic level. Positive detection of a transgene in food may, however, need careful interpretation because, for example, fermentation processes are usually performed in nonsterile environments.

13 Methods for Detection of Genetically Modified Microorganisms

These may contain numerous additional microorganisms, including unknown or unculturable species. Their properties and genetic endowment is unknown and may be a source for new properties which might occur and then be detected in a fermentation organism. This property might even be identical with any that has been incorporated by genetic modification. When GMMs are used for the production of food, four categories of detectability can be differentiated: 1. the product is free of any DNA and impurities indicative of a GMM, for example highly purified food ingredients or additives; 2. the product contains DNA but no GMM, for example liquid products (beer or wine) that were subjected to separation processes such as filtration or centrifugation; 3. products that contain the dead GMM with its DNA, for example a pasteurized yoghurt or baked goods; and 4. products containing the living GMM, for example a nonpasteurized yoghurt, cheese, beer, sauerkraut, fermented sausage, etc. It is evident that detection of involvement of a GMM in the production process of category 4 food is rather easy to perform. Not only is the DNA readily available, can be extracted, and the modification traced in all detail, but the organisms can also be cultured and their physiology and biochemical properties can be investigated. Finally, the organisms can be identified down to the strain level. This may be important when the GMM used as a constituent of a starter culture, probiotic food, or protective culture must be identified. For this purpose all methods can be applied that are commonly used for identification on the genotype or phenotype level. When culture is not needed or not possible, for example when the organisms

Level genotype

Detection methods DNA

coding region promotor coding region

PCR, hybridization newly introduced gene

mRNA

phenotype protein

storage protein

enzyme

immunoassay catalysis

product of catalysis

analysis of metabolites

processing secondary products

denatured proteins

Fig. 13.1 The unambiguity of methods used for the detection of GMO in food.

Unambiguity

271

272

13.2

Current Methods for Detection of GMM

acquire a status of “viable but not culturable” (VBNC), it is possible to confirm the presence of live or dead cells by fluorescence-staining techniques then microscopy or, when applicable, flow cytometric analysis [8, 9]. There is a gradual transition from category 3 to category 2 foods. When a GMM is killed by application of heat and then immediately frozen the DNA and more or less all other components remain accessible for analysis, although in a partially denatured form. When, in contrast, when the cells lyse, either spontaneously or even when this is induced by genetic modification, the conditions for detection of the GMM are similar those for category 2 food. Induced lysis has been an object of studies on accelerated ripening of cheese [10, 11] brought about by hydrolytic (proteolytic) activity released from the GM-starter cultures. Detection of a genetic modification in a dead GMM in food is usually quite easy as long as the DNA is kept within the compartment. It was shown by Straub et al. [12] that physicochemical and enzymatic degradation of DNA in dead cells is much less than for free DNA. Because, for detection of DNA, the molecule must be extracted, the strength of inclusion of the DNA has to be taken into account. DNA is usually easier to extract from Gram-negative bacteria and from yeasts than from Gram-positive bacteria, and attention must also be paid to components of the food that may interfere with detectability (see below). Isolation of transgenic DNA from the food may, therefore, require thorough purification which, in turn, must be adjusted to the location of the transgene, i.e. chromosomal or plasmid integration. Finally, the target of detection – DNA, protein, or metabolite – may undergo severe degradation or denaturation, depending on the process condition to which a food is subjected. The effects of factors such as heat, pH, and enzymatic attack in food have been studied by Bauer (unpublished results) and those generally exerted by shearing forces have been described by Lengsfeld and Anchordoquy [13]. These processes, with separation techniques and deliberate enzyme application, may finally lead to category 1 food. For these, detection of a GMM or its effect on the food is not feasible.

13.2 Current Methods for Detection of GMM

Methods for detection of GMM in sausages and yoghurt were established and published in the late 90s after validation in ring trials [14, 15]. The analytical procedure for detection of GMM in foods is depicted in Fig. 13.2. In this example, fermented sausages were produced with the recombinant strain L. curvatus LTH 4002 used as starter. This GMM harbors plasmid pLSC300 encoding the catalase gene katA of L. sakei LTH 677 [5]. The sausages were then subjected to the analysis [14]. Total DNA was isolated from hom*ogenized sausages by use of a universal phenol–chloroform extraction method. The efficiency of extraction was checked by agarose gel electrophoresis. For unambiguous detection of the recombinant strain, primers were constructed which target katA and its border sequence within the plasmid. This approach takes into account that most strains of L. sakei contain katA and that this species can be present in the indigenous ripening flora of fermented sau-

13 Methods for Detection of Genetically Modified Microorganisms total DNA

DNA isolation

kat18

cmr3

PCR

agarose gel electrophoresis

specific PCR products of 1321 bp

Southern blot and hybridization

hυ

hybrids of specific PCR product and DIG-labelled DNA-probe

detection assay with APantibody, targeted against DIG

Fig. 13.2 Detection of the genetically modified strain L. curvatus LTH 4002 in fermented sausages by use of the official method of the German food act LMBG § 35. AP, alkaline phosphatase; DIG, digoxigenin.

sages. The specific primers are used for amplification of a 1321-bp fragment of pLSC300 by PCR. In parallel, the amplifiability of the isolated DNA was checked by amplification of a 1025-bp fragment of the 16S rDNA using universal primers. The lengths of the amplified DNA fragments were determined by agarose gel electrophoresis. In addition, the amplified sequence was validated by Southern hybridization using a nonradioactive labeled oligonucleotide probe targeted against the nested sequence. This analytical procedure corresponds closely to the validated method for a detection of genetically modified strain of Streptococcus thermophilus in yoghurt [15], with the exception that the DNA extraction method was adapted to this special food matrix. The GMM had been endowed with the cat gene encoding resistance to chloramphenicol. Again the specific primers were targeted against the recombinant gene (cat) and its border sequence within the chromosome (lacZ gene) to unambiguously identify the recombinant nature of the organism.

273

274

13.3 DNA Isolation

Isolation of DNA is the first step in analysis for detection of the use of GMM in food by molecular methods. When the cells are not lyzed, the GMMs may first be separated from the food matrix by hom*ogenizing the food and separation of the cells by filtration and centrifugation. The DNA can subsequently be isolated in accordance with published procedures. To optimize the yield of isolated DNA the method must be adapted in accordance with the taxonomic position of the GMM. For DNA extraction the example described above [14] can again serve as an example. It uses a universal phenol–chloroform extraction procedure to isolate the total DNA from fermented sausages containing living cells of the GMM. The use of this method to obtain DNA of high quality, suitable for DNA detection by PCR, has been demonstrated for thermally treated fermented sausages [12] and for cream [16]. The method has also been adapted for isolation of total DNA from yoghurt, including bacterial genomic DNA of Streptococcus thermophilus [15]. These two methods were validated in a ring trial and added to the official collection of methods according to the German Food Act LMBG § 35 (now § 64, Commodity and Feed Act LFGB). When the GMM is killed during processing of fermented foods and its DNA is released into the food matrix, the free DNA must be isolated directly from the food matrix. Because most approved GMOs are plants, much information is available on the isolation of DNA from plant material. Zimmermann et al. [17] compared nine different extraction methods including CTAB, Wizard, DNeasy, and others. Isolation of DNA with commercial kits such as Wizard or DNeasy, on the basis of specific binding of DNA to resins, resulted in high-quality DNA but the yield was lower than for other methods. The resin-based isolation methods were recommended, however, because the quality of the DNA was regarded as most important. DNA-based detection of GMM may be hampered by the presence in the food matrix of inhibitors that interfere with cell lysis, degrade DNA during isolation, or interfere directly with the PCR itself. Numerous compounds or substances which inhibit PCR have already been identified; examples include organic or phenolic compounds, glycogen, and milk proteins [18]. For meat and milk products, especially, heme and Ca2+ have been found to be strong PCR-inhibitors [19, 20]. The PCR can also be inhibited by contaminants in reagents or by disposables, for example glove powder. False-negative results can be eliminated by using external or internal standards for PCR-based detection methods to monitor the efficacy of PCR [21]. For analysis of foods, heterologous internal standards (so-called mimics) have been successfully used for reliable detection of the food pathogens Yersinia enterocolitica [22] and Camplylobacter coli/jejuni [23].

13 Methods for Detection of Genetically Modified Microorganisms

13.4 DNA Stability

The persistence of the recombinant DNA in fermented foods is of major concern in the detection of GMM by DNA based methods. As long as the DNA is contained in cells, it is naturally protected against degradation. Straub et al. [12] showed that the DNA from genetically modified Lactobacillus curvatus strains used as starter organism for production of summer sausages was strongly protected against enzymatic or physical attack, even when it is contained in dead cells. In contrast, DNA released from cells into the food matrix, as occurs in the course of food processing, undergoes physical, chemical, and enzymatic degradation. Numerous ecological factors prevail during production and storage of foods; these can either enhance the degradation of free DNA or contribute to protecting it against degradation. It was shown by Straub et al. [12] that free plasmid DNA in summer sausages remained detectable after storage for nine weeks. These results, and those obtained in challenge experiments performed to investigate the effect of added DNase I in sausages, indicate that the meat matrix had a protective effect on free plasmid DNA. Further information of DNA stability in milk was reported by Bräutigam et al. [24], who showed that free bacterial DNA remained detectable for 12 days in ultra high temperature-treated milk stored at 4 °C whereas storage at 20 °C resulted in a rapid degradation within a few days. Processing of fermented foods can also include a final heat-treatment step for pasteurization of the product, for example summer sausages, yoghurt, and beer. In summer sausages neither the temperature employed in the heat treatment nor the fat content or pH significantly affected the detectability of free recombinant DNA in the product [12]. A combination of the heat treatment with other degrading factors may result in additive or synergistic effects. For example, Klein et al. [25] reported that the different steps applied in the process of sugar production contribute to severe degradation of free plasmid DNA. The overall efficacy of DNA elimination can be calculated to ca. 1014. Hotzel et al. [26], on the other hand, showed that residual DNA from yeasts used for the production of beer can still be detected by PCR in the final product despite the prevailing acidic conditions (pH ca. 4.5).

13.5 Organism-specific Detection of the GMM

Assessment of the safety of foods containing viable GMM raises a number of unique issues, for example pathogenicity, toxigenicity, genetic stability, and gene transfer that may not be relevant when assessing foods containing nonviable GMM or products thereof. Guidelines and recommendations have been published to give a structured approach to assessment of the safety of GMMs [27, 28]. It is generally required that the full taxonomic profile of the host organism be provided, down to the strain level where appropriate. Thus, there is a need to determine the taxonomic position of the GMM and to identify the strain. To ensure that the recom-

275

276

13.5 Organism-specific Detection of the GMM

binant DNA detected is contained in the very host strain that had been used for construction of the GMM, detection of the recombinant DNA must, furthermore, be combined with identification of the host organism. This measure takes into account the possibility of horizontal transfer of recombinant DNA between different strains, species, or even less-related organisms. Ludwig et al. [29] have published an overview of DNA-based methods which can be used, especially for this type of a combined GMM detection approach. The methods are based on specific DNA probe hybridization and on diagnostic DNA in-vitro amplification. Taking into account the contaminating or indigenous microbiota which can be present with the GMM in foods, it is evident that living cells are required for the combined use of probes and/or PCR primers specific for the recombinant DNA and the microorganism. The methods available are highly sensitive, but are applicable to living GMM exclusively. Ribosomal RNAs (rRNA) have been proven to be excellent phylogenetic markers [30] and can be used as targets for the taxonomic identification of the GMM. The molecules contain both evolutionary highly conserved and less conserved sequence positions and regions, which report on earlier and more recent events, respectively, in the evolution of the organism. These regions can contain taxonomically (phylogenetically) relevant signature positions, which are diagnostic for groups of phylogenetically related organisms, for example family, genus, or species. They often provide useful target sites for taxonomic (phylogenetic) probes and primers, which can be used in combination with a variety of hybridization and PCR techniques [29, 31, 32]. Numerous oligonucleotide probes and primers for specific detection of the species of fermentation organisms have already been published and can be obtained from the literature. The availability of comprehensive 16S rRNA sequence databases and software packages, for example ARB, facilitate the rapid rational design and in silico specificity profiling of such probes and primers [33]. When pure cultures of the GMMs are available, a variety of hybridization techniques, for example dot/slot blot or colony hybridization, and diagnostic PCR techniques can be applied. For example, colony hybridization has been successfully used to detect a genetically modified Lactococcus lactis subsp. lactis in pure and mixed cultures and in fecal samples [34, 35]. The proteinase-negative strain was modified by introducing the proteinase gene prtP. The unambiguous detection of the GMM was ensured by combined use of probes specific for the recombinant gene and the species Lactococcus lactis. In addition, the recombinant DNA was reliably detected by using a diagnostic PCR system. The primary structures of the rRNAs are usually too conserved to provide strainspecific probe or primer target sites. Techniques based on the detection of strainspecific DNA sequences by applying hybridization or PCR techniques with specific probes or primers are available, however. These unique sequences can be derived, for example, from RAPD fragments [36] or may be obtained by the subtraction hybridization technique [37, 38]. Use of the latter method to develop strain-specific PCR-based detection systems for food fermenting organisms has been demonstrated [39, 40]. Bunte et al. [40] used such a PCR system to monitor the strain Lactobacillus paracasei LTH 2579 in fermenting sausages and human fecal samples.

13 Methods for Detection of Genetically Modified Microorganisms DNA of LTH4002

DNA of subtracter strains

Sau3A digestion and ligation with linker P linker S

Fig. 13.3 Schematic illustration of subtraction hybridization (modified from Ref. [39]).

amplification of linked fragments by PCR

biotinylation subtraction hybridization

magnetic separation of the labelled hybrids and strain specific sequences

Enrichment of strain-specific DNA fragments by PCR

Minor sequence variations between closely related strains of the species L. paracasei were identified by subtraction hybridization using the genomic DNA of the target strain and five subtracter strains. The principle of subtraction hybridization is depicted in Fig. 13.3. On hybridization, a nonhybridizing DNA fragment of 235 bp was obtained. This fragment can be used as DNA probe either for hybridization or for the development of a diagnostic PCR system. The specificity of the PCR system was validated using numerous strains of the species L. paracasei.

13.6 Conclusion

The plasticity of the bacterial genome, the frequency of horizontal gene transfer, and the application of self-cloning complicate the detection of GMM in foods, especially when recombinant DNA is naturally present within a rich indigenous or contaminating flora. If results are to be unambiguous, detection of recombinant DNA and identification of the host organism are required; intact cells of the GMM are required for this approach, however. For this purpose, specific and sensitive molecular methods are available. Because no GMM have been admitted for release

277

278

References

and placing on the market of products obtained with their aid, validated data for detection of legally approved GMM do not exist. Detection methods have, nevertheless, been established for model foods. Thus, with certain limitations, it is possible to detect GMM in food as long as their genetic background is well described, as is legally required during the course of the application procedure.

References 1 ILSI, Detection Methods For Novel Foods Derived From Genetically Modified Organisms, ILSI Europe Report Series. Brussels, Belgium, 1999. 2 R. Meyer, Food Control 1999, 10, 391–399. 3 E. Gachet, G. G. Martin, F. Vigneau, G. Meyer, Trends Food Sci. Technol. 1998, 9, 380–388. 4 A. Pasqualone, Industrie Alimentari. 1999, 39, 444–451. 5 C. Hertel, G. Schmidt, M. Fischer, K. Oellers, W. P. Hammes, Appl. Environ. Microbiol. 1998, 64, 1359–1365. 6 ACNFP, Annual Report 1990, Department of Health, Ministry of Agriculture, Fisheries and Food, UK, 1990. 7 M. Curic, B. Stuer-Lauridsen, P. Renault, D. Nilson, Appl. Environ. Microbiol. 1999, 3, 1202–1206. 8 J. S. Miller, J. M. Quarles, Cytometry 1990, 11, 667–675. 9 G. Nebe-von-Caron, P. J. Stephens, C. J. Hewitt, J. R. Powell, R. A. Badley, J. Microbiol. Methods 2000, 42, 97–114. 10 B. A. Law, Int. Dairy J. 2001, 11, 383–398. 11 L. U. Guldfeldt, K. I. Sorensen, P. Stroman, H. Behrndt, D. Williams, E. Johansen, Int. Dairy J. 2001, 11, 373–382. 12 J. A. Straub, C. Hertel, W. P. Hammes, Z. Lebensm. Unters. Forsch. 1999, 210, 62–67. 13 C. S. Lengsfeld, T. J. Anchordoquy, J. Pharmaceut. Sci. 2002, 91, 1581–1589. 14 Anonymous, L 08.00-44. Untersuchung von Lebensmitteln : Nachweis einer gentechnischen Veränderung in Rohwurst durch Amplifizierung der veränderten DNA-Sequenz mit Hilfe der PCR und Hybridisierung des PCR-Produktes mit einer DNA-Sonde. In: Amtliche Sammlung von Untersuchungsverfahren nach § 35 LMBG, BgVV, Lose Blattsammlung, Beuth, Berlin/Köln, 1996.

15 Anonymous, L 02.02-4. Untersuchung von Lebensmitteln : Nachweis einer gentechnischen Veränderung von Streptococcus thermophilus in Joghurt durch Amplifizierung der veränderten DNA-Sequenz mit Hilfe der PCR und Hybridisierung des PCR-Produktes mit einer DNA-Sonde. In: Amtliche Sammlung von Untersuchungsverfahren nach § 35 LMBG, BgVV, Lose Blattsammlung, Beuth, Berlin/Köln, 1997. 16 J. A. Straub, C. Hertel, W. P. Hammes, J. Food Prot. 1999, 62, 1150–1156. 17 A. Zimmermann, J. Luthy, U. Pauli, Z. Lebensm. Unters. Forsch. 1998, 207, 81–90. 18 I. G. Wilson, Appl. Environ. Microbiol. 1997, 63, 3741–3751. 19 A. Akane, K. Matsubara, H. Nakamura, S Takahashi, K. Kimura, J. Forensic Sci. 1994, 39, 362–372. 20 J. Bickley, J. K. Short, D. G. McDowell, H. C. Parkes, Lett. Appl. Microbiol. 1996, 22, 153–158. 21 B. C. Trapnell, Am. J. Physiol. 1993, 264, L199–212. 22 S. Thisted Lambertz, A. Ballagi-Pordany, R. Lindquist, Lett. Appl. Microbiol. 1998, 26, 9–11. 23 J. A. Straub, C. Hertel, D. Made, W. P. Hammes, Z. Lebensm. Unters. Forsch. 1999, 209, 180–184. 24 M. Braeutigam, C. Hertel, W. P. Hammes, FEMS Microbiol. Lett. 1997, 155, 93–98. 25 J. Klein, J. Altenbuchner, R. Mattes, J. Biotechnol. 1998, 60, 145–153. 26 H. Hotzel, W. Müller, K. Sachse, Eur. Food Res. Technol. 1999, 209, 192–196. 27 SCF, Commission Recommendation 97/618/EEC concerning the scientific aspects of the presentation of information necessary to support applications for the placing on the market of novel foods and novel food ingredi-

13 Methods for Detection of Genetically Modified Microorganisms

30 31

ents and the preparation of initial assessment reports under regulation (EC) No 258/97 of the European Parliament and of the Council, Official Journal of the European Communities, L253, Brussels, 1997. ILSI, Safety assessment of viable genetically modified microorganisms used in food, ILSI Europe Report Series, Brussels, Belgium, 1999. W. Ludwig, E. Brockmann, C. Beimfohr, C. Hertel, B. Jacobsen, K. H. Schleifer, Syst. Appl. Microbiol. 1995, 18, 477–485. W. Ludwig, K. H. Schleifer, FEMS Microbiol. Rev.. 1994, 15, 155–173. K. H. Schleifer, W. Ludwig, R. Amann, Nucleic acid probes. In: M. Goodfellow, O. McDonnell (eds.) Handbook of New Bacterial Systematics, pp. 463–510, Academic Press, London, 1993. R. Amann, W. Ludwig, K. H. Schleifer, Phylogenetic identification and in situ detection of individual microbial cells

33 34 35

36 37 38

39 40

without cultivation. Microbiol. Rev. 1995, 59, 143–169. R. Amann, W. Ludwig, FEMS Microbiol. Rev. 2000, 24, 555–565. C. Hertel, W. Ludwig, K. H. Schleifer, Syst. Appl. Micobiol. 1992, 15, 447–452. E. Brockmann, B. L. Jacobsen, C. Hertel, W. Ludwig, K. H. Schleifer, Syst. Appl. Microbiol. 1996, 19, 203–212. A. Tilsala-Timisjärvi, T. Alatossava, Appl. Environ. Microbiol. 1998, 64, 4816–4819. A. J. Bjoursen, J. E. Cooper. Appl. Environ. Microbiol. 1988, 54, 2852–2855. V. G. Matheson, J. Munakata-Marr, G. D. Hopkins, P. L. McCarty, J. M. Tiedje, L. J. Forney, Appl. Environ. Microbiol. 1997, 63, 2863–2869. L. Wassill, W. Ludwig, K. H. Schleifer, FEMS Microbiol. Lett. 1998, 95, 87–94. C. Bunte, C. Hertel, W. P. Hammes, Syst. Appl. Microbiol. 2000, 23, 260–266.

279

Index (ISS1)-mediated transposition 251 1-sucrose:sucrose fructosyl transferase [1-sst] 50 2,3-butanediol 74 2-μm plasmids 70 35S-CaMV promoter 46, 54, 180, 206-208, 210, 212, 213, 225, 231, 234, 245, 246 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) 31, 201, 206 5-fluoroorotic acid 79, 99, 100 α-acetolactate 74, 120 α-casein 15 α-lactalbumin 14-15 Phe-free 15 β-actin 190 β-carotene 48, 61 β-casein 14, 15 β-glucanase 51, 73, 90, 98 β-glucan 51, 73 β-glucuronidase (GUS) 31 β-lactoglobulin 14, 15 δ-endotoxins 41 γ-linoleic acid 83 χ-casein 14, 15

a ABA-inducible promoter 46 abiotic stress tolerance 45 abortive infection (Abi) 117 abuse principle (Mißbrauchsprinzip) acetaldehyde 120 acetic acid 110 acetoin 74 acetone cyanohydrin 50 acetyl CoA carboxylase 15 acid tolerance 121 acrylamide 84 additives 136 ADE1 68, 69 adenine 158

138

ADP-glucose pyrophosphorylase 226 Agaricus bisporus 95 AGPase 226 Agreement on Technical Barriers to Trade 147 Agreement on the Application of Sanitary and Phytosanitary Measures 147 Agrobacterium rhizogenes 27 Agrobacterium tumefaciens 27, 55 agronomic properties 47 pyrophosphatase 47 sprouting time 47 alaD 120 alanine dehydrogenase 120 alanine racemase 120 aldC 74 alfalfa 43, 46, 59, 61 alfa amylases 98 all-fish gene cassette 193, 197 all-salmon gene cassette 194 all-tilapia construct 195 alr 120 aluminum-activated malate transporter 47 aluminum tolerance 47, 61 AMA (autonomous maintenance in Aspergillus) 81 amdS 80, 102 amylases 99 amylase promoter 102 amyloglycosidase 98, 102 angiotensin-I-converting enzyme 120 Anguilla spp. 198 animal health 16, 18 alpha-herpesvirus 18 cows 13, 14, 16, 18 Staphylococcus aureus 18 animal welfare 16, 20 antibiotic resistance genes 30 aadA 30 hpt 30

282

Index nptII 30 antifreeze protein 190-192 antimicrobial peptides 18, 43, 44 antisense RNA 117 APETALA (AP1) 48 apple 41, 43, 44, 60, 76 apple scab 43, 60 aquaculture biotechnology 187 ARA 81 Arabidopsis 45, 46, 48, 54, 61 arachidonic acid 49, 81, 83 Arctic charr (Salvelinus alpinus) 188, 190, 192 arginine deiminase 121 ARS sequence 70, 72, 81 artificial chromosomes 4, 10, 21 ascorbic acid 48, 49, 188 asparaginase 84 aspergillopepsin 83 Aspergillus aculeatus 75, 91, 96 Aspergillus awamori 94, 96, 97, 101, 102, 103 Aspergillus fetidus 96 Aspergillus gossypii 83 Aspergillus japonicus 96 Aspergillus nidulans 78, 81, 91-93, 102 Aspergillus niger 68, 79, 80, 82-84, 92, 96-99, 101-103 Aspergillus niger var. awamori 83 Aspergillus oryzae 65, 66, 76, 79, 82, 83, 93, 95-7, 99, 101-103 Aspergillus sake 95 Aspergillus spp. 66 Aspergillus sydowii 83 ATF1 75, 76 Atlantic salmon (Salmo salar) 186, 188, 191, 192, 193 ATPase 121 attP-site 32 auxin 50 Ayu (Plecoglossus altivelis) 188

b Bacillus subtilis 119 Bacillus thuringiensis 201 bacterial blight 44, 60 bacterial resistance 44 attacins 44 barley lipid transfer protein LTP2 cecropins 44 hydrogen peroxide 44 lysozyme 44 mangainin 45 pyramiding strategies 44 sarcotoxins 44

bacterial spot disease 44, 60 bacteriocin 114, 115 Bacteriophage 116 bacteriophage 116, 251-253, 270 BK5-T 252 prophage 270 bacteriophage resistance 116 antisense RNA 117 phage-encoded resistance (per) 117 bakers’ yeast 67, 73, 76, 77, 85, 86, 95 bakery products 111 baking quality 51 bananas 43, 52 barley 42-44, 47, 51, 52, 58-62, 65, 73, 98 barley yellow dwarf virus 42, 58 Basic Regulation 137, 138, 144, 147, 148 Basta 31 batch fermentation 105 bayanus 73 beans 42, 202-244 beer 51, 64-66, 72-74, 85, 86, 90, 98, 271, 275 benomyl 80 bialaphos 31, 70 bioconservation 115 biologically active peptides 120 bioluminescence 31 biopreservation 115 Biotechnology Act 148, 149 Bio Track database 144 Brassica napus 54, 59 Brassica rapa ZSR 500, 501, 502 36 bread 65, 76, 83 Brettanomyces lambicus 65 Brettanomyces bruxellensis 65 brewers’ yeast 72-74 brewing yeast 72, 74, 85, 86, 90 Brie 66 BSE 18 Bt-toxin 201 Bundesamt für Verbraucherschutz und Lebensmittelsicherheit (BVL) 147 Bündnerfleisch 67 butter 111 buttermilk 111

c 44

c-ski proto-oncogene 12 Cyprinus carpio 195 cabbage 113 Cachaca (Aguardente) 65, 66, 86 Camembert 66 CaMV 35S promoter 206, 210, 211, 213 Candida krusei 65, 86

Index Candida spp. 65 Candida stellata 65 carcinoembryogenic antigen (CEA) 54 carotenoids 48 Carp (Cyprinus carpio) 187, 188, 190 carrots 45, 59 Cartagena Protocol 140 caseins 119 cassava 50, 111 catabolite repression 77 catalase 121 catfish 187 cecropin B 190 cellulose pulp 83 cephalosporins 30 cereals 65, 217 certified reference material 203 Champagne 65 Channel catfish (Ictalurus punctatus) 188, 190 chaperone BipA 83 chaperons 121 cheese 15, 64, 66, 77, 82, 84, 87, 94, 95, 98, 110, 111, 114-16, 119, 126, 127, 130, 271, 272 chicory 40, 208 Radicchio Rosso 208 RM3-3, RM3-4, RM3-6 40 Chinook salmon (Oncorhynchus tshawytscha) 188, 191 cholera toxin B subunit gene (CTB) 53 Chrysophrys major 189 Chrysosporium lucknowense 82 chymosin 98 Cichlidae 194 citric acid 96 citrus trees 48 Clostridium spp. 115 Clostridium tetani toxin C-fragment 123 CMV-tiGh-CAT-SV40 194 co-existence 142, 146 CO2 110, 115 coconut 66 cod 198 Codex Alimentarius Commission 147 codon 160 Coho salmon (Oncorhynchus kisutch) 188, 191, 194, 196, 198 cold-shock proteins 121 Comitology Decision 138, 141 Commission Recommendation No. 2003/556/EC 146 Community Reference Laboratory 137 Community Scientific Committee 139

composite foods 219, 220-223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247 cold pressed oils 228 complementary competitive PCR 232 distillation 226 DNA degradation 223, 228, 232 fermentation 226 mechanical treatment 238 protein denaturation 224 rapeseed 228 refined oils 228 sugar manufacture 226 congenital immunization 17 conjugation 116, 250 continuous fermentation 105 corn 41, 54, 57, 98, 184, 227, 232, 236, 238, 243, 244, 259 corn rootworm 41 cotton 33, 34, 36, 38, 41, 43, 207, 224, 226, 231, 242, 245 19-51A 36, 207 281-24-236 38 3006-210-23 38 31807/31808 38 Bollgard 38, 207 BXN 36, 207 Ingard 207 LL Cotton 25 36 MON 1445/1698 33, 36 MON 15985 34, 38 MON 531, 757, 1076 34, 38 MON 88913 36 cracker 111 cre-loxP 71 CRE/LOX system 32 creA 81, 103 criminal offence 151 cryoprotection 121 CTAB 205, 235 cucumber 39, 42, 43, 57, 58, 59, 113 cucumber mosaic virus 39, 42, 57, 58 Cutthroat trout (Oncorhynchus clarki) 188, 191 cyanogenic glycosides 50 cysteine 19, 45, 49 cysteine-rich metallothionein-like protein 49 cytosine 158

d dairy products 111 Danio rerio 186 Danish Danbo 66 Debaromyces spp. 65 Debaryomyces hansenii 66

283

284

Index dehydration-stress tolerance 45, 46, 60 osmoprotectants 45 dehydroascorbate reductase 48 Deliberate Release Directive 1990 136, 148 Deliberate Release Directive 2001 140, 141, 145, 146, 148, 149 depurination 222 detection 81, 155-247, 253, 259, 261, 265, 267, 269, 271-279, 283-291 amplicon length 237 antibodies 214, 215 aphA 228 biological approaches 177 bioinformatic considerations 172 border sequence 272 CaMV 35S promoter 213 Coho salmon 196 colony hybridization 276 competitive PCR 231 competitive PCR 232 complementary competitive PCR 232 CP4 EPSPS 224, 234 cryIA(b) 234 CryIA(b) protein 224 CTAB 236, 274 degradation 272 detection limits 230 diagnostic PCR 276 DNA 272 DNA-based Methods 163-185, 224 DNA-based procedures 260 DNA degradation 226, 236, 237 DNA extraction 225, 239 DNA microarrays 174, 175 DNA stability 275 DNeasy 274 dual competitive PCR 232 ELISA 263 enzyme-immunoassay 173 event-specific 208, 210, 231 event-specific quantitation 232 exhaustive limiting dilution PCR 262 false-negative results 179, 274 false-positive results 169, 179 food matrix 274 fresh raw juice 228 GC content 238 genetically modified crops 81, 155- 247, 253, 259, 261, 265, 267 genetically modified Lactococcus lactis 259 genetically modified microorganisms 274 genetically modified organisms 219, 220, 222, 224 226, 230 genetic label 265

genotype 270, 271 Isothermic amplification 173 katA 272 Lactobacillus curvatus 272, 273, 275 Mach–Zehnder interferometer 264 maize 231, 234 marker rescue 175, 177 mass spectrometry 176, 264, 265 microarrays 262 microfluidic systems 176 milling products 235, 236 nanoparticles 174, 175 neomycin phosphotransferase 228 NOS-Terminator 215 nucleotide sequence-based procedures 262 organism-specific 275, 276, 288 OnMTGH1 196 PCR 260 phenotype 270, 271 photon-driven methods 176 phylogenetic markers 276 plant species-specific 209 primers 213, 214, 215 protein-based methods 164, 224 protein-based procedures 263, 264 protein chips 264 protein Cry9C 214 qualitative PCR 225, 261 quantification 212 quantitative PCR 230, 261 Real-time PCR 233, 261 real-time PCR 233-238, 261 Recommendation 2004/747 203 Roundup Ready soya-specific 211 sample preparation 259 sampling 165, 202-204 sausages 272, 274, 275 screening 206-208, 210 self-cloning 269, 270 single-nucleotide polymorphism 262 soy 234 soybean-specific 211 soybean flour 238 starter cultures 229 subtraction hybridization 277 surface plasmon resonance 175, 264 target sequences 206, 208, 209 thermal cycling procedure 173 threshold 216 threshold regulation 201 transgenic constructs 208 transgenic fish 196, 197 transgenic soya 210

Index two-dimensional gel electrophoresis 264, 265 validation 212, 213 verification 211 Western hybridization 263 Wizard extraction 236, 274 yoghurt 272, 274 detection 196, 202, 204, 226, 230, 263, 264, 274 detection assay 158-160 deliberate modification 162 target molecule 160 unknown modifications 162 dextrins 73 diacetyl 74, 113, 115, 120 Directive 104, 137, 141, 142, 144, 148, 161, 269 2000/13/EC 142 2001/18/EC 137, 141, 144, 148, 161 90/219/EEC 161, 269 98/81/EC 104 DNA 4, 158-162, 165-167, 202, 204, 205, 221-223, 226 array technology 105 degradation 221-223, 226 extraction 50, 136, 164-167, 172, 184, 196, 202, 204, 205, 212, 222, 225, 229, 235, 236, 238, 242, 243, 260 fragmentation 222, 223, 226 hybridization 162, 166-169, 171, 174-176, 182, 184, 192, 194, 211, 228, 233, 260-263 isolation 202, 204, 205, 274 microinjection 4 microarrays 174, 175 nonenzymatic hydrolysis 222 purification 105, 165, 166 purity 205 quality 204 vaccines 16 DNA-binding silica columns 205 docosahexaenoic acid 49, 83, 94 domesticated fish 13 downstream processing 105 DtpP, DtpT 119 durum wheat 51

e EC Biotechnology Implementation Act 148, 151 eel 198 EFSA 137, 139-141, 144, 146 eggplants 41, 51 eicosapentaenoic acid 84 electroporation 8, 12, 28, 55, 189

electrospray MS 176 ELISA 201, 224 enzyme-linked immunosorbent assays 224, 263 enzymes 124 epitopes 123 EPS 118, 119 EPSPS 201, 206, 210 Erwinia amylovora 44, 60 Erwinia carotovora subsp. atroseptica 44 Erwinia carotovora subsp. carotovora 44 erythropoietin 53 ethanol 83, 110 ethics 20 ethyl caproate 76 European Food Safety Authority 137 exopoly saccharides 118, 119 glycosyltransferases 119 explosive expression vectors 117 expression system nisA promoter 123 histidine protein kinase 122 response repressor 122 extracellular immunization 17 extraction solvents 136

f farm animals 3-25 farm animals biosafety 20 FAS2 76 fatty acid acryl-elongases 49 fatty acid acyl-desaturases 49 fed-batch fermentation 105 Federal Office for Consumer Protection and Food Safety (BLV) 147, 148 fermentation 106, 107 fermented foods 109 fermented food of plant origin 65 fermented sausages 111 ferritin 49, 62 filamentous fungi 65, 72, 78-87, 92, 93, 95, 99, 100, 103, 105, 110 acetamidase 102 auxotrophic marker 99 bidirectional markers 100 GRAS (generally regarded as safe) 97 orotidine-59-phosphate decarboxylase 99 nitrate reductase 100 protoplast transformation 78 recombinant DNA technology 78, 97 single-cell protein 84 xylanases 84 fire blight 44, 60 fish 111, 186-197

285

286

Index farming 186 gene cassette 189-191 gonado-somatic index 195 hepato-somatic index 195 viscera-somatic index 195 flavor 74, 75 flavorings 136 flavor compounds 124 flax 36 FP967 36 FLO1 74 FLO11 74 FLO5 74 FLO8 74 flocculation 74 fluorescence correlation spectroscopy 176 fluorescence resonance energy transfer (FRET) 170, 171 folic acid 120, 121 food-grade gene-delivery system 117, 118 food-grade modifications 161 food-grade plasmids 256 selection marker 256 food-processing aids 98 food additives 95-107, 124 food analysis performance-assessment scheme 164 food biotechnology 112 food fermentation 64-94, 105, 109, 110, 111, 113, 115, 117, 119, 121, 123, 124, 125, 127, 129, 131, 269, 270 DNA Stability 275 liquefaction of fruit 84 Food Industry 98 food pathogens 115 food preservation 116 food quality 48 improved amino acid composition 49 increased iron level 49 increased vitamin content 48 production of “low-calorie sugar” 50 production of very-long-chain polyunsaturated fatty acids 49 reduction in the amount of antinutritive factors 50 seedlen fruits and vegetables 50, 51 food safety 196-197 dimethylamine 198 formaldehyde 198 gene product 197 pleiotropic effects 198 substantial equivalence 196 transgenic fish 198 Förster resonance energy transfer 212

FRET 170 fructan 50, 62 fruit mashes 114 fruit pulp 84 functional foods 110 fungal resistance 43 apple scab 43, 60 chitinase 43, 58, 59 hypersensitive response 43, 44 phytoalexin 43, 59 ribosome inactivating proteins 43 sheath blight 43, 58 stinking mut 43 thaumatin-like protein 43, 58, 59 Fusarium equiseti 83 Fusarium oxysporum 83 Fusarium venenatum 84, 94, 95, 97, 99, 101

g Gadus morhua 198 galactose 120 gene-disruption 100 generation time 48, 61 genetically engineered food 135-153 genetically modified crops 201-217 35S-promoter 206-208 chicory 208 cotton 207 detection 201-217 nos59-terminator 206-208 nptII gene 30, 206-208 papaya 208 potato 37-39, 57, 207, 209, 215, 242 rapeseed 207 soya 210 soybean 207 tomato 207 genetically modified feed 142 genetically modified filamentous fungi 64-107 γ-linoleic acid 83 acetamidase 80 Agrobacterium tumefaciens-mediated transformation 79 amyloglycosidase promoter 103 amyloglycosidase terminator 103 antibiotic resistance markers 104 arachidonic acid 83 autonomously replicating vectors 81 auxotrophic markers 79, 101 biolistic transformation 79 cellobiohydrolase I 80 cellobiohydrolase I promoter 103 docosahexaenoic acid 83

Index drug-resistance markers 79, 80 electroporation 79 expression vector 101, 103 general protease regulator 101 gene disruption 99, 101 glucoamylase 80 Heterologous integration 81 hom*ologous integration 80 nitrate reductase 79 nonhom*ologous end-joining 81 orotidine-59-decarboxylase 79 polyunsaturated fatty acids 83 promoter 101-103 riboflavin 83 ribozymes 82 RNA interference 81 selection marker 102 self cloning 104 TAKA promoter 103 tandem integration 101, 102 thaumatin 83 Xylanases 83 translational terminator 101 transposon-arryed gene knock-outs 80 genetically modified food 135-150 Genetically Modified Food and Feed Regulation 137, 138 genetically modified Lactococcus lactis 259 genetically modified medicinal products 142 genetically modified microorganisms 269-291 colony hybridization 276 detection 274 diagnostic PCR 276 DNA isolation 274 Lactobacillus curvatus 272, 273, 275 sausages 272, 275 Streptococcus thermophilus 273 yoghurt 272, 273 genetically modified organism 149, 219-247 detection 219-224, 230 genetically modified plants 27-63, 101, 104, 123, 161, 178, 256, 257 1-sucrose:sucrose fructosyl transferase [1-sst] 50 abiotic stress tolerance 45 β-glucanase 51 ACC, sense 40 ACCd 40 Agrobacterium transformation 27 agronomic properties 47 altered gluten level 51 Altered Grain Composition 51 alternative markers 32

aluminum tolerance 47 als 36 antibiotic resistance 31, 34, 36, 38-41, 55, 101, 104, 123, 161, 178, 256, 257 antibiotic resistance genes 30 antibody against carcinoembryogenic antigen 54 APETALA (AP1) 48 bacterial blight 44 bacterial resistance 44 bacterial spot disease 44 bar 33, 35-37, 39, 40 barnase 39, 40 barstar 39 BayTE 41 bla 33, 35, 37, 40, 41 Brassica rapa 36 bxn 36, 38 chicory 40, 208 codon usage 30 cholera toxin B subunit gene (CTB) 53 cotton 33 coat protein CMV 39 coat protein PRSV 39 coat protein PVY 38, 39 coat protein WMV 2 39 coat protein ZYMV 39 CP4 EPSPS 33, 35-37 cry34Ab1, 37 cry35AB1 37 cryIA(b) 37 cryIAb 33, 37, 38 cryIAc 34, 37, 38 cryIF 37 cryIFa2 33, 37, 38 cryIIIA 37-39 cryIIIBb1 37 cryIIIBb2 33, 37 cysteine-rich metallothionein-like protein 49 CZW-3 39, 208 dam 40 dehydroascorbate reductase 48 delayed ripening 40 direct gene transfer 28, 55 excision systems 32 fatty acid acryl-elongases 49 fatty acid acyl-desaturases 49 ferritin 49, 62 fertility restoration 40 fire blight 44 FLAVR SAVR 40 flax 36 food quality 48

287

288

Index generation time 48 thioredoxin 52 glutenins 51 tissue requirements 29 glyphosate-resistant crop 31 tobacco 43-59, 63 GmFad2-1 41 tolerance to low iron 47 gox 35, 36, 37 tomato 38, 40, 207 GTS-40-3-2 33, 35 transformation of protoplasts 28 gus 35, 39, 41 transcription factor DREB1A 46 HAL1 47 tumor-inducing plasmid (Ti) 27 helicase PLRV 38, 39 uidA 34, 38 hepatitis B surface antigen (HbsAg) 52, vacuolar Na+/H+ antiport 46 53 virus resistance 17, 34, 36, 38, 39, 42, 43, herbicide resistance 30, 31, 33-40, 56 58 hirudin 54 wheat 34, 36, 51, 209 hydroxynitrile lyase (HNL) 50 yeast Dbf2 kinase 46 insect resistance 32, 34, 37, 38, 39, 41, 42, genetically modified processing aid 142 55, 57, 208, 224, 226, 227 genetically modified yeast 64-93 insect-resistant cotton 32, 224 α-acetolactate decarboxylase 74 insect-resistant maize 32, 224 α-amylase (AMY1) 73 late blight 44 α-l-rhamnosidase 75 LEAFY (LFY) 48 β-1,4-glucanase 75 LEA protein 46 β-d-glucosidase 75 LT-B subunit gene 53 β-glucanase 73 lycopene β-cyclase 48 alcohol acetyltransferase 75 maize 34 antibiotic resistance 69 maize EPSPS 33, 35 beer flavor 74 male sterility 33, 34, 36, 40 bialaphos 70 manA gene 32 biomass yield 77 Mn superoxide dismutase 46 complementing an auxotrophy 69 modified fatty acid content 36, 41 disruption of ALD6 and ALD7 76 nptII 33, 35, 36, 37, 38, 39, 40, 41 dominant markers 70 nptII, aad 33, 34, 36, 38, 39 endopolygalacturonase 75 oat arginine decarboxylase 46 fatty acid synthase 76 oil-seed rape 33-36, 39-41 flocculation 74 papaya 39, 208, 215 FLP-FRT recombinase 71 partial bla 33, 35 geneticin 418 69 particle bombardment 28 glucoamylase (GAM1) 73 pat 33, 35-38, 40 glycerol-3-phosphate dehydrogenase 74 PG, sense or antisense 40 heterologous marker 69 phytase 49 hygromycin B 70 phytoene desaturase 48 malate permease (MAE1) 73, 76 phytoene synthase 48 malic enzyme 73, 76 production of pharmaceuticals 53 maltase 77 production of vaccines 52, 53 maltose-permease 77 promoter 29 melibiase gene (MEL1) 73 proteaseinhibitor II (pinII) 37 neomycin 70 pyrophosphatase 47 non-Saccharomyces Strains 77 replicase PLRV 38, 39 nourseothricin 70 reporter gene 30, 31, 36, 38, 39, 41, 55 overexpression of GPD1 76 salt tolerance 46, 47 reduction of ethanol content 74 sam-K 40 refining and clarification 75 seed albumin gene (AmA1) 50 sake flavor 76 selectable marker genes 30, 55 selection marker 69, 70 soybean 33-35, 41, 57, 207, 245 sugar utilization 75 squash 39, 208 sulfate reductase 76

Index transcription factor Hap4p 77 valine biosynthetic pathway 74 wine flavor 75, 76 geneticin 30 geneticin 418 69 genetic engineering 56, 109-131, 149, 152, 186-199, 256, 258, 267 α-acetolactate decarboylase 120 “food-grade” vectors 123 AbiQ 117 alanine dehydrogenase 120 alanine racemase 120 antisense RNA 117 bacteria 109 bacteriophage resistance 116-118 bioconservation 115 catalases 121 epitopes 123 EPS-biosynthesis clusters 118 EPS overexpression 118 exopolysaccharides 118 explosive expression vectors 117 expression 122, 192 fish 186-198 flavor development 119 gene cassette 192 gene delivery systems 122 gene disruption 119 gene transfer 189, 192 glycosyltransferases 119 histidine protein kinase 122 lactobacilli 113 Lactobacillus spp. 111 Lactococcus lactis 110, 256, 257 Leuconastoc citreus 114 Leuconastoc mesenteroides subsp. mesenteroides 114 Leuconastoc spp. 113, 114 metabolic engineering 120 NADH-oxidase 120 neutral proteinase 119 nisA promoter 123 Pediococcus spp. 114 peptidases 119 phage-encoded resistance 117 phage triggered suicide traps 117 protein targeting 123 proteolysis 120 response repressor 122 serine hydroxymethyltransferase 120 site-directed mutagenesis 116 Streptococcus thermophilus 113 stress response 121, 122 transformation 122

vaccine 123 genetic modification 81, 155-247, 253, 259, 261, 265, 267 detection 81, 155-247, 253, 259, 261, 265, 267 food-grade modifications 161 marker rescue 178 self-cloning 161, 162 unintended effects 178 gene cassette 189-192 gene delivery systems 122 gene disruption 100, 101, 104 gene disruption plasmid 99 gene replacement 104, 258 gene silencing 10 Poultry 7 gene transfer 3-11, 13, 16-18, 20, 28, 30, 55, 56, 61 fish 8 exchange of function 9 lain of function 9 ross of function 9 Reduction of function by RNAi 9 genotype 3, 14, 28, 99, 100, 157, 158 Geotrichum candidum 65 GH 12, 13 GHRH 12 Globodera 45, 60 Glu-B1 promoter 49 glucans 75 glucocerebrosidase 53 glucose isomerase 98 glucose transporter type 1 190, 191 glusulase 78 glutenins 51 glycerol 76 glycinebetaine 45, 60 glyoxylate cycle 19 glyphosate 31, 34, 36, 38, 226, 227 GM-free zones 146 GMO 138-50, 163, 172 monitoring 172 golden rice 48 gonado-somatic index 195 Gorgonzola 66 GPD1 74 Gram-positive bacteria 123 grapes 41, 43, 45, 65, 75-77, 91, 98 grapefruit 41, 42 grape vine 43 GRAS 123 Grass carp (Ctenopharyngodon idellus) 188 Group I intron 253 Group II intron 251

289

290

Index growth hormone 190, 192 growth hormone-releasing hormone GHRH 11 growth hormone 1 191 growth hormone GH 11 growth hormone polyA site 190, 191 Gt-1 promoter 49 guanine 158 gulonolactone oxidase 191

h HAL1 gene 47, 61 Hansenula polymorpha 72, 89, 95, 103 HARS sequences 72 heat shock response 121 heme 121 hemicellulose 75 hepatitis B antigen 53 hepatitis B surface antigen (HbsAg) 52 hepato-somatic index 195 herbicide resistance genes 31 bar/pat gene 31 EPSPS gene 31, 34, 36, 38, 210, 226, 227 heterofermentative 110, 113 hexokinase type II 190, 191 hirudin 54, 63 HIS1 69, 89 histone 3 190, 191 hom*ofermentative 110, 114 horizontal gene transfer 163, 270, 277 host range 115 HSP30 promoter 74 human immunodeficiency virus 123 human lactoferrin 15 human lysozyme 15 Humicola insolens 83 HXT permease gene 75 HybProbes 169, 171 hydrogen peroxide 115, 121 hydrogen sulfide 74 hydroxynitrile lyase (HNL) 50 hygromycin B 30, 70, 80, 88, 92 hygromycin phosphotransferase 30 hypersensitive response 43, 44

i icasopentaenoic acid 49 IGF-1 12 immunochromatographic strip test 224 immunological tolerance 53 industrial enzyme production 105, 106 submerged fermentation 105 surface fermentation 105 inevitable traces 150

influenza viruses 17 innate immune system 17, 18 insect-resistance 32, 34, 41, 42, 55, 208, 224, 226 alpha-amylase inhibitor 42, 57 B. t.-toxins 41 corn rootworm 41 chicken avidin gene 42 lectins 42 proteinase inhibitors 42, 43, 45 rice brown planthopper 42, 57 insertional mutagenesis 4, 6, 7, 21 Institute for Reference Materials and Measurements 203 insulin-like growth factor 1 IGF-1 12 intracellular immunization 17 introns 160 intron homing 251, 253 ISO 13690 202 ISO/DIS 21568:2005 203 isopentenyltransferase (IPT) 31 ISS1 257 IS elements 252, 253

k kanamycin 30, 34, 36, 38, 39, 40, 41 kefir 67 keratin 19 Kluyveromyces lactis 66, 69, 87, 89, 95, 103 Klyveromyces 77 kombucha 65, 77, 86 KU70 81 KU80 81

l l-alanine 120 L18 ribosomal protein 190 lab-on-a-chip 176 labelling of foodstuffs 141 LAC4 103 laccases 98 lactase 15, 98 lactate dehydrogenase 120 lacticin 3147 115, 116 acne 116 cheese manufacture 115 dental caries 116 mastitis control 115 lactic acid bacteria 110-112, 114, 118-124 “food-grade” vectors 123 amino acid auxotrophy 119 genome sequences 112 recombinant DNA technology 120 transformation 122

Index Lactobacillus acidophilus 111, 112 NCFM 112 Lactobacillus amylolyticus 111 Lactobacillus brevis 112 ATCC367 112 Lactobacillus casei 111, 112 ATCC334 112 Lactobacillus confusus 65 Lactobacillus curvatus 111, 121, 269, 272, 273, 275 border sequence 273 cat 273 LTH 4002 272, 273 pLSC300 272, 273 yoghurt 273 Lactobacillus delbrueckii subsp. bulgaricus 111, 112, 118, 126, 128, 130 ATCC BAA-365 112 Lactobacillus fermentum 111 Lactobacillus gasseri 112 ATCC33323 112 Lactobacillus helveticus 111 Lactobacillus johnsonii 112 NCC 533 112 Lactobacillus plantarum 111, 112, 128, 129 WCFS1 112 Lactobacillus reuteri 111, 112 Lactobacillus rhamnosus 118 Lactobacillus sake 111, 121 Lactobacillus sakei 112 23K 112 Lactobacillus sanfrancisco 111 Lactobacillus ssp. 111 Lactococcus lactis 73, 110-12, 115, 118-132, 248-267, 276 aerobic conditions 121 cointegrates 251 conjugation 250 electroporation 252 genetic engineering 256, 257 genetic flexibility 254 genetic plasticity 253 gene replacement 258 genome 249, 250 group II intron 251 insertion vectors 256 IS elements 252, 253 ML3 251 mutagenesis 258 mutations 255 mutation strategies 255 NCDO712 251 open reading frame 249 pLP712 252, 254

pLR333 256 pLR334 256 pORI 256 pORI13 257 pORI19 257 pORI240 257 pORI280 257, 258 prophages 253 pRS01 251 pWV01 256 pWV02 256 random mutagenesis 257 RepA+ helper strain 256 replication slippage 255 sex factor 251 transduction 251, 252 transformation 252 transposon 253 Lactococcus lactis subsp. cremoris 110-112, 249-252, 254 C2 250, 251 H2 252 MG1363 110, 112, 249, 254 ML3 250, 251 NCDO712 250, 251, 252, 254 QA5 249 SK11 110, 112, 249 Lactococcus lactis subsp. lactis 110-112, 125, 131, 249, 252, 254, 276 IL1403 110, 112, 249, 254 Lactococcus lactis subsp. lactis var. diacetylactis 111 lactoferrin 14 lactose 16, 120 lambic beer 65 lantibiotic 115 late-embryogenesis-abundant (LEA) proteins 45 Lateolabrax japonicus 189 late blight 44 LCR 173 LEAFY (LFY) 48 Lebensmittel- und Futtermittelgesetzbuch (LFGB) 138 lettuce 41, 53 LEU2 68, 69, 70 Leuconostoc citreum 112 KM20 112 Leuconostoc lactis 111 Leuconostoc mesenteroides 111, 112 Leuconostoc mesenteroides subsp. cremoris 111 Leuconostoc mesenteroides subsp. mesenteroides 113 ATCC8293 112

291

292

Index ligase chain reaction 173 Limburger 66 Listeria monocytogenes 115 Listeria spp. 115 long terminal repeat 190 LT-B subunit gene 53 luciferase 31, 56 luciferin 31 lycopene 48 lycopene β-cyclase 48 lysine 19, 49 lysostaphin 18 lysozyme 14

m Mach–Zehnder interferometer 264 Macrozoarces americanus 186 mae1 76 mae2 76 Magnaporthe grisea 43, 58, 59, 81 maize 33-35, 37, 40, 55, 65, 152, 203, 206, 209, 213, 214, 227, 228, 244 176 227 59122 214 676, 678, 680 40 Bt11 33, 37, 206, 213, 227 Bt11 sweet maize 214 Bt 176 33 Bt Xtra 206 B 16 = DLL 25 35 DAS-06275-8 37 DAS-59122-7 37, 214, 215 DBT 418 37, 206 event 176 (Maximizer) 213 GA21 214, 227 GA 21 33, 35 LibertyLink T25 206 MaximizerBt-176 206 MON80100 227 MON802 227 MON809 227 MON810 227 MON810 (Yield Gard) 206, 213 MON832 227 MON863 214 MON88017 228 MON 80100 37 MON 802 37 MON 809 33, 37 MON 810 33, 37 MON 832 35 MON 863 33, 37 MON 88017 37 MS3 40

MS6 40 NK603 214, 228 NK 603 33, 35 Roundup Ready GA21 206, 213 Roundup Ready NK603 206 StarLink (CBH 351) 206, 213 TC 1507 33, 37, 214 transgenic event Bt10 214 T 14 35 T 25 33, 35, 214 T 25 (Liberty Link) 213 Yieldgard MON 810 206, 213 maize 29, 32-36, 41-43, 49, 52, 57, 59, 65, 86, 92, 136, 165, 168, 169, 181-185, 202, 203, 209-214, 223-238, 242-247 Bt 176 32, 33, 37, 165, 226, 231, 234-237 MON 810 32, 206 T 25 32, 181, 182, 202, 206, 213, 214, 234, 244 malate 73, 114 MALDI–TOF 176 male sterility 39 malic acid 76 malolactic conversion 114 MalR, MalS, MalT 77 malting quality 51 maltose 77 marker rescue 175, 177 mass spectrometry 264, 265 detection 265 mastitis 16, 18 meat 11, 12, 19, 20, 64, 66, 67, 77, 81, 82, 84, 109-111, 121, 127, 142, 163, 194, 223, 229, 274, 275 MEL1 77 melibiose 73, 114 MET2 75 MET10 68, 75, 76 MET14 75 MET25 74 metabolic engineering 104, 120 metabolomics 104 metallothionein 190, 191 methionine 49, 78, 91, 160, 209 methionol (3-methylthio-1-propanol) 77, 78 methylotrophic yeasts 103 microarrays 262 microinjection 189 microprojectile bombardment 189 MIG1 77 MIG2 77 milk 14, 15, 119, 120 casein content 14 humanized 14

Index human milk protein 14 low-lactose 16 Millet 65 misdemeanor 151 miso 66, 77, 95 Mn superoxide dismutase 46 molecular beacon 171 molecular farming 53, 63 monoclonal antibodies 263 Moromi 66 Mortierella alpina 81 Mozarella 113 mRNA 157, 158, 159, 160 Mucor circinelloides 83 Mucor spp. 66 Mud loach (Misgurnus mizolepis) mutagenesis 257, 258 transposition 257 mycoparasitic fungi 43, 59 mycoprotein 84 Mycosphaerella graminicola 80 myostatin 12, 13

188, 190

n NADH-oxidase 120 nanotechnology 174 NASBA 173 negative labeling 149, 145, 150 nematode resistance 45 cowpea trypsin inhibitor 45 cysteine proteinase inhibitors 45 oryzacystatin 45 neomycin 30, 70, 88, 201, 206, 228 neomycin phosphotransferase (NPTII) 30 neomycin phosphotransferase gene 206 neomycin phosphotransferase II 201 Neurospora crassa 81 Neurospora sitophila 66 neutraceuticals 124 NFI 149, 150 niaD 79 NICE system 123 nicotianamine aminotransferase 47, 61 nisA promoter 123 expression system 123 nisin 115, 122 NisK, NisR 122 nkuA 81 nopaline synthase terminator 206 Northern blot 192 nos59 206 nos59-terminator 206, 207 genetically modified crops 206 nourseothricin 70

Novel Foods and Food Ingredients Instrument 145, 149 Novel Food Regulation 135, 136, 139, 145, 149, 219 Novozym 234 78 NptII 201 nptII gene 206, 207 genetically modified crops 206 nuclear transfer 6, 7, 10, 18, 20 cats 6 cattle 6 deletive gene transfer 7 dogs 6 fetal fibroblasts 6 goats 6 horses 6 knock-in 7 knock-out 7 mules 6 pigs 6 rabbits 6 replacement gene transfer 7 nucleic acid sequence-based amplification 173 nutraceuticals 16, 20 nutritional starvation 121

o oats 42, 58 ocean pout 186 OECD 144 Oenococcus oeni 112, 114, 124, 126 IOB 8413 112 IOEB8413 114 MCW PSU-1 112 Oenococcus spp. 114 PSU-1 114 off-flavor 74 Official Journal of the EU 141 Ogogoro 65, 66 oil-seed rape 33-36, 39, 40, 41, 43, 47, 54 23-18-17 41 23-198 41 GT 200 35 GT 73 33, 35 HCN 10 35 HCN 28 = T45 33 HCN 28 = T 45 35 HCN 92 s= Topas 19/2 33 HCN 92 = Topas 19/2 35 high-laurate canola 41 MS1 RF1 33, 39 MS1 RF2 33, 39 MS8 RF3 33, 39

293

294

Index Oxy 235 36 PHY14 39 PHY35 39 PHY36 40 oligomycin 80 olives 65, 111 Oncom 66 Oncorhynchus clarki 191 Oncorhynchus kisutch 191, 194 Oncorhynchus mykiss 191 Oncorhynchus nerka 194 Oncorhynchus tshawytscha 186, 191 OnMTGH1 196 OPAFPcsGHc 192, 193, 195 open reading frames 160 Opp 119 oranges 43 Oreochromis hornorum 194 Oreochromis niloticum 195 osmoprotectant 45 osmotic stress 121 overexpression of genes 104 ovule-specific promoter (DefH9) 51 oxidative stress 121 oxygen 121

p Pacific Chinook salmon 186 palm juice 65 papaya 36, 39, 42, 47, 208, 215 55-1 215 55-1/63-1 39 66-1 215 PARS sequences 72 parthenocarpic fruits 50 partitioning elements 70 parvalbumin 198 PCR 167-173, 176-181, 183, 184, 192, 196, 201, 202, 205, 209-212, 225, 230, 231, 234-237, 240, 243-246, 260, 261, 274 allele-specific 168 analytical 212 asymmetric 168 competitive 168, 169, 230, 231 control PCR systems 209 conventional 167, 168, 169 differential 168 differential display reverse transcription 178 end-point 261 FCS-based 177 inhibitors 274 monitoring gene transfer 192 multiplex 168, 211

multiplex nested 169 nested 168, 205, 210, 211, 212 plant species-specific 209 quantitative 169 real-time 169-172, 179-181, 183, 184, 205, 210, 212, 216, 230, 234-237, 240, 243-246, 261 reverse-transcribed 192 sensitivity 225, 230 single 205 soya-specific 209 species-specific 202 specificity 225, 230 verification 211 PCR-ELISA 169, 205 PCR-LCR 173 PCR-LCR-EIA 173 peanut 41, 42, 57, 66, 82 pear 44 pea 42, 57 pectinases 98 pectins 75 Pediococcus acidilactici 111, 114 Pediococcus pentosaceus 111, 112, 114, 125, 126, 256 ATCC25745 112, 114 Pediococcus spp. 114 PEG 122 PEG-transformation 28 Penicillium 66, 67, 81, 82, 92, 95 Penicillium camemberti 66 Penicillium nalgiovense 67, 81, 92 Penicillium roqueforti 66, 83, 84 Pep 119 pepper 44, 51, 60 peptidases 119 per 117 peroxidases 121 pG+HOST 257 PGK1-promoter 76 phage-defense systems 116, 117 phage-encoded resistance 117 phage-triggered suicide traps 117 pharmaceuticals 29, 53, 54 phenotype 10, 13, 48, 69, 81, 82, 117, 157-160, 198 phleomycin 80 phosphinotricin 31 phosphinotricin acetyltransferase 31, 206 phosphomannose isomerase 32 phytase 19, 49 phytic acid 49 phytoene desaturase 48 phytoene synthase 48

Index Phytophthora infestans 44, 92 Pichia 77 Pichia anomala 65 Pichia methanolica 95 Pichia pastoris 72, 88, 89, 95, 103 pineapple 42, 45 pito 65 plants 10, 20, 27-63 plant products 111 Plasmodium falciparum merocoite stage surface antigene 123 plum tree 42 pluripotent embryonic stem cells 189 poly(ethylene glycol) 122 polyclonal antibodies 263 polymerase chain reaction (PCR) 164 polysaccharides 118 polyunsaturated fatty acids 83 poly A site 190 Pombe (beer) 65 pOnMTGH1 194 pORI 256, 257 pG+HOST 257 pVE6007 257 Port Salut 66 post-translational processing 160 potato 34, 36-47, 49, 50, 52-54, 57, 60-63, 184, 202, 207, 209, 215, 224, 226, 242, 244 ATBT04-6 38 Atlantic and Superior New Leaf 38 B33-INV 226 Bt 6, Russet Burbank New Leaf 37 NewLeaf 207 NewLeaf Plus 207, 215 NewLeaf Y 38, 39, 207, 215 RBTM 21-350 38, 39 Russet Burbank 207 Russet Burbank New Leaf Plus 38, 39 SEMT 15-15 38, 39 potato leafroll virus 38, 39, 42 probiotic LAB 123 procedure-related labeling 161 processed food 219-247 coarse grits 237 cold pressed oils 228 complementary competitive PCR 232 distillation 226 DNA degradation 223, 228, 229, 232, 236, 237 extrusion 229 fermentation 226 fermented, heat-treated sausages 229 flour 237 heat-sterilized kernels 235

heat treatment 226, 233 mechanical treatment 238 milling 235, 236, 239 protein denaturation 224 rapeseed 228 refined oils 228 sugar manufacture 226 thermal treatment 238 toast bread 229 prohibition principle (Verbotsprinzip) 138 proline 45 promoter 4, 8, 9, 12, 17, 19, 21, 29, 32, 46, 47, 49, 50, 51, 53-55, 70, 74, 76, 80, 101-103, 119, 122, 123, 131, 173, 175, 178, 180, 186, 189-192, 194, 195, 196, 206-208, 210-213, 225, 226, 231, 234, 238, 243, 245, 246, 253, 256, 269 cauliflower mosaic virus 35S RNA 29 constitutive 12, 17, 29, 43, 46, 50, 54, 58 maize ubiquitin 1 gene (ubi1) 29 nopaline synthase (nos) 29 octopine synthase (ocs) 29 rice actin 1 gene (act1) 29 proteases 99, 121 protein 67, 84, 89, 158, 160, 214, 215, 221, 222, 224, 242, 263, 264 degradation 222 denaturation 221 epitopes 222 hydrolytic fragmentation 222 protease-catalyzed cleavage 222 protein Chips 264 protein targeting 123 proteolysis 119, 120 flavor development 119 proteomics 104 provitamin A 48, 61, 62 pRS01 251 PrtP 119 Pseudomonas syringae pv. tomato 44 puffer fish 198 pullulanase 52, 62 putrescine 45, 46, 61 pyrG 79, 92, 99-103 pyrophosphatase 47, 61

q QC–PCR 205 Quorn 84, 94, 95

r raffinose 114 Rainbow trout (Oncorhynchus mykiss) 191, 192

188,

295

296

Index ramification amplification 174 RAPD 276 rapeseed 207, 228 23-18-17 207 23-198 207 HCN92 207 LibertyLink Innovator 207 MS8 RF3 207 Ready 207 real-time PCR 169-172, 179-184, 205, 210, 216, 230, 233-237, 240, 243-245, 261 molecular beacons 233 TaqMan Probes 233 redfish 198 Regulation (EC) 135-139, 141, 142, 144, 145, 148, 150-152, 161, 217, 219 No. 258/97 136 No. 50/2000 136 No. 1829/2003 136-142, 144, 145, 148, 150, 161 No 1830/2003 137, 219 No. 1946/2003 145, 148 No 65/2004 144, 152, 219, 241 No 641/2004 139 Reinheitsgebot 73 replication 160 reporter genes alternative markers 31 gusA gene 31 luc gene 31 restriction-modification 117 restriction fragment length polymorphism 196 resveratrol 76 retroviral vectors 5, 9 biosafety 5 genetic 5 lentiviral vectors 5 oncoretrovirus-based vectors 5 replication-defective 5 RFLP 196 rhaA 75 Rhizoctonia solani 43, 58, 59 Rhizopus oligosporus 66 Rhizopus spp. 66 riboflavin 83 ribosome-inactivating proteins (RIPs) 42 ribozyme 82 rice 29, 34, 36, 41-49, 54-62, 65, 66, 76, 82, 169, 183 LLRICE 06, 62 36 rice brown planthopper 42, 57 rice tungro spherical virus 42, 58 risk assessment 139, 140

RNA 157, 158 RNAi 9, 10, 15, 18, 81, 82 RNA interference 10, 81 Rohu (Labeo rohita) 188 rolling cycle amplification 174 Roquefort 66 Roundup 31, 180, 206-208, 210, 211, 213, 215, 226, 231, 234, 236, 238, 244-247, 260 rRNA 157, 159, 276

s S-adenosyl-methionine 78 Saccharomyces bayanus 65, 72, 73, 90 Saccharomyces carlsbergensis 72 Saccharomyces cerevisiae 65, 67-70, 72, 73, 75-77, 81, 85-93, 95, 104, 124 Saccharomyces monacensis 72 Saccharomyces patorianus 72 Saccharomyces spp. 65 safety assessment 140 sake 65, 66, 76, 95 salmon 187 Salmo salar 186, 191 salt tolerance 45-47, 60, 61, 82, 86, 91, 96, 116, 166, 204 sampling 202, 203, 204 cross-contamination 203 ISO 13690 202 ISO/DIS 21568:2005 203 maize kernels 203 sample preparation 203, 204 soya or maize flour 203 soya or maize grits 203 soy beans 203 sauerkraut 111 sausage 114, 272 Schizosaccharomyces 77 Schizosaccharomyces pombe 65, 69, 73, 76, 77, 89, 91, 95 scrapie 18 Sebastes spp. 198 seed albumin gene (AmA1) 50 selectable marker 10 selection marker 69, 70, 79, 101, 102, 116, 117, 125, 130, 206, 256 dominant markers 69 heterologous marker 69 self-cloning 104, 161, 162, 256, 269, 270, 277 serin-protease 119 serine hydroxymethyltransferase 120 sex factor 251 shelf-live 115 shoyu (Soy sauce) 66, 95 siderophores 47

Index silage 114 Silver sea bream (Sparus sarba) 188 single-cell protein 84 single-nucleotide polymorphism 262 siRNAs 10 small heat-shock proteins 121 SNP 262 Sockeye salmon 194 somatoliberin 11 somatomedin C 12 somatotropic hormone STH 11 somatotropin release-inhibiting factor SRIF, somatostatin 11 sorghum 65 sourdough 76, 111 sour maize gruel 65 Southern blot 166, 167, 192, 228, 260, 273 soya 215 Roundup Ready 215 soybean 33-36, 41-43, 45, 49, 57, 62, 66, 82, 136, 158, 166, 169, 180-183, 202, 203, 207, 208, 211, 217, 224, 226, 210, 224, 229, 231, 234, 235, 242, 244-247, 259 A 2704-12 35 A 2704-21 35 A 5547-127 35 A 5547-35 35 G94-1 41 G94-19 41 G168 41 GTS-40-3-2 33, 35 GU 262 35 high-oleic soybean 41 W 62 35 W 98 35 soy milk 114 soy sauce 77, 82, 111 Sparus auratus 189 spectinomycin resistance 30 sperm-mediated transfer 189 spongiform encephalopathies 18 SPR 177 sprouting time 47 SPS Agreement 147 squash 39, 208 CZW-3 39, 208 FreedomZW20 208 Freedom CZW-3 208 ZW20 39, 208 SSU1 75 stacked genes 34 Standing Committee on the Food Chain and Animal Health 138, 141 Staphylococcus spp. 115

starch 73 starter cultures 110 stearoyl-CoA desaturase 15, 16 Stilton 66 stinking mut 43 strand-displacement amplification 174 Streptococcus spp. 115 Streptococcus thermophilus 112, 113, 118-120, 124-126, 128, 130-132, 273, 274, 278 CNRZ1066 112 exopolymer synthesis 113 LMD9 112 LMG18311 112 phage resistance 113 Streptomyces hygroscopicus 31 Streptomyces viridichromogenes 31 streptomycin resistance 30, 34, 36, 38, 39 stress response 121, 122 submerged fermentation 105 substantial equivalence 196 subtraction hybridization 276, 277 sucrose 114 Südtiroler Bauernspeck 67 sufu (tofu) 66 sugar cane 41, 42, 55, 65 sugar beet 32, 36, 42, 50, 56, 62, 138, 222, 226, 228 GTSB 77 36 H7-1 36 T120-7 36 sulfur dioxide 74 sunflower 41 surface plasmon resonance 175, 177, 264 sweet potato 42 Swiss-type cheeses 113 SYBR-green 169, 170 systems biology 104, 105

t T-DNA 27, 29 takadiastase 96 TAKA amylase 103 Taq polymerase 167, 170, 205 exonuclease activity 170 TaqMan Probes 169 tartaric acid 76 TBT Agreement 147 tea extract 65 TEM-1 β-lactamase 30 temocillin 30 tempe 66 terpenoids 75 thaumatin 83 Thaumatococcus danielii 83

297

298

Index thioredoxin 52, 62 cattle 5, 6, 7, 10, 12, 13, 18 thymine 158 cloning capacity 5 tilapia 187, 192 congenital immunization 17 tilapia (Oreochromis hornorum) 188, 190 cows 14 tilapia (Oreochromis niloticus) 188, 190 disease resistance 11, 16, 17, 18, 44, 59, Tilletia tritici 43 60 Tilsiter 66 disease resistance gene Mx1 17 tolerance threshold 146 embryo transfer 5 tolerance to low iron 47 ethics 20 nicotianamine aminotransferase 47 extracellular immunization 17 tomato 36, 38, 40-48, 51, 52, 57-62, 138, 181, fatty acids desaturase 19 202, 205, 207, 208, 223, 226 feed conversion efficiency 11 1345-4 40, 207 feed efficiency 12 35 1 N 40 fiber products 11 5345 38 fish 8, 11, 13, 14, 18, 20, 49 8338 40 food safety 20 B, Da, F 40 foster mothers 5 Flavr Savr 40, 207 gene transfer efficiency 5 Torulaspora delbrueckii 65 goats 16 traceability 143 growth rates 11, 12 transboundary movements 146 hom*ozygous 4 transcription 157, 160, 162 intracellular immunization 17 transcription factor DREB1A 46 mice 4-6, 10, 12-14, 17, 18 transcriptomics 104 milk composition 14, 15 transduction 251, 252, 270 novel biochemical pathways 11 transformation 27-29, 55, 59, 61, 62, 122 nuclear transfer 6 protoplast transformation 122 piglets 5 transgene 3-21, 27-30, 42-61 pigs 4-7, 12, 16, 17, 19, 25 additive gene transfer 8 pluripotent stem-cell technology 6 boundary elements 4 pork 19 DNA microinjection 8 poultry 7 epigenetic silencing 6 pronuclear DNA microinjection 4 expression 3-18, 21, 27, 29, 30, 42-46, pseudorabies-resistant 18 48-61 rabbits 4, 6, 17 gene constructs 8, 10 resistance Genes 17 germ-line transmission 6 resistance to mastitis 16 introgression 21 retroviral vectors 5 nonectopic expression 21 ruminants 12, 14 position-independent expression 4 salmonids 14 position effects 4 sheep 6, 7, 12, 17, 18, 19 silencing 8 swine 6, 17 transcriptional shutdown 5 transchromosomic 10 transgenesis 4-6, 11-13, 16, 19, 20 viral protein 17 transgenic animals 3-26, 43, 46, 48-50, 52, wool production 19 55, 57-63 transgenic fish 13, 187-199 additive gene transfer 17 antifreeze protein 188 agricultural traits 11 antifreeze protein promoter 189 animal health 16, 18 ascorbic acid 188 animal welfare 20 Atlantic salmon 193 antifreeze proteins (AFP) 14 body composition 13, 193 Bbiochemical pathways 19 carbohydrate utilization 188 biomedicine 21 carp 13, 195 biosafety 20 catfish 13 carcass composition 11, 12 disease resistance 188

Index enhanced growth 188 feed digestibility 193 food safety 196, 197 growth rate 13, 193 histone H3 promoter 189 human growth hormone 189 metallothionein promoter 189 muscle biochemistry 194 Pacific salmon 194 Pluripotent embryonic stem cells 189 subtractive hybridization 194 tilapia 13, 195 translation 157, 160 transposon 253 Trappist 66 Trichoderma harzianum 43, 60 Trichoderma longibrachiatum 75, 97 Trichoderma reesei 80, 82, 97, 99, 101, 103 Trichoderma spp. 83 trimethylamine oxide demethylase 198 Triticum turgidum L. var. durum 51 tRNA 157, 159 TRP1 68, 69 tryptophan 49, 158, 160 tuber-specific patatin promoter 47, 53 two-dimensional gel electrophoresis 264

u unique identifier 143, 144 URA3 68, 69, 89, 103 uracil 158 urease 121 Ustilago maydis 43

v vaccines 52, 53, 62, 123, 124, 129, 130 validation 212, 213 detection 213 vegetables 114 verification 211 virus resistance 10, 28, 39, 42, 57, 58 barley yellow dwarf virus 42, 58 cucumber mosaic virus 39, 42, 57, 58 gene silencing 10, 28, 42 pathogen-derived resistance 42 potato leafroll virus 38, 39, 42 ribosome-inactivating proteins (RIPs) 42 rice tungro spherical virus 42, 58 wheat streak mosaic virus 42, 58 viscera-somatic index 195 vitamin C 48

w walnut

watermelons 51 wheat 34, 36, 42, 43, 46, 47, 49, 51, 52, 54, 58-62, 65, 66, 76, 83, 93, 209, 244 MON 71800 36 wheat streak mosaic virus 42, 58 White Paper on Food Safety 136 wine 65, 66, 73, 75, 76, 90, 91, 114 wine yeast 73, 75, 76, 85, 86, 90, 91 Wizard extraction 235 wool 19, 20 follicles 20 growth factors 20 keratin synthesis 19 World Trade Law 147 World Trade Organization (WTO) 147

x Xanthom*onas oryzae pv. oryzae xylanases 83 xylans 75 xylitol 83

44, 60

y Yarrowia lipolytica 72, 89, 95 yeast 4, 10, 46, 47, 52, 53, 61, 64-95, 103, 104, 107, 108, 142, 237, 265, 269 β-galactosidase promoter 103 alcohol oxidase 1 promoter 103 centromeric plasmids (YCp) 70 electroporation 69 episomal plasmids (YEp) 70 formate dehydrogenase promoter 103 integrative plasmids (YIp) 70 integrative vector 71 lithium acetate method 68 methanol oxidase 1 promotor 103 molecular transformation 67 recombinant DNA technology 67 retrotransposon Ty1 71 self replicating plasmids 70, 103 shuttle vectors 70 spheroplast method 67 transformation 69, 72 yeast artificial chromosomes (YACs) 4 yeast Dbf2 kinase 46 Yellow River carp 196 yogurt 111, 113, 120, 272, 273

z zebra fish 186, 187 Zygosaccharomyces 77 Zygosaccharomyces bailii 65 Zygosaccharomyces rouxii 66, 77, 86, 88, 91 zymolyase 78

299

Genetically Engineered Food: Methods and Detection 2nd ed - PDF Free Download (2024)